ID: 1041653292

View in Genome Browser
Species Human (GRCh38)
Location 8:60322512-60322534
Sequence CCAAGGCTGTAGACAAAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041653288_1041653292 -3 Left 1041653288 8:60322492-60322514 CCCTGGCTCAGGGTCTCTCACCA No data
Right 1041653292 8:60322512-60322534 CCAAGGCTGTAGACAAAGTGTGG No data
1041653289_1041653292 -4 Left 1041653289 8:60322493-60322515 CCTGGCTCAGGGTCTCTCACCAA No data
Right 1041653292 8:60322512-60322534 CCAAGGCTGTAGACAAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041653292 Original CRISPR CCAAGGCTGTAGACAAAGTG TGG Intergenic