ID: 1041653294

View in Genome Browser
Species Human (GRCh38)
Location 8:60322518-60322540
Sequence CTGTAGACAAAGTGTGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041653288_1041653294 3 Left 1041653288 8:60322492-60322514 CCCTGGCTCAGGGTCTCTCACCA No data
Right 1041653294 8:60322518-60322540 CTGTAGACAAAGTGTGGGCTTGG No data
1041653289_1041653294 2 Left 1041653289 8:60322493-60322515 CCTGGCTCAGGGTCTCTCACCAA No data
Right 1041653294 8:60322518-60322540 CTGTAGACAAAGTGTGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041653294 Original CRISPR CTGTAGACAAAGTGTGGGCT TGG Intergenic
No off target data available for this crispr