ID: 1041658276

View in Genome Browser
Species Human (GRCh38)
Location 8:60375913-60375935
Sequence GGGCCCAGATGCAGGCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041658271_1041658276 21 Left 1041658271 8:60375869-60375891 CCACATATTGAGGAACATTGTTG No data
Right 1041658276 8:60375913-60375935 GGGCCCAGATGCAGGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041658276 Original CRISPR GGGCCCAGATGCAGGCCCAG AGG Intergenic