ID: 1041659473

View in Genome Browser
Species Human (GRCh38)
Location 8:60387284-60387306
Sequence CAATTCTTTCAGACTTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041659471_1041659473 -10 Left 1041659471 8:60387271-60387293 CCCAACGCAGACACAATTCTTTC 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1041659473 8:60387284-60387306 CAATTCTTTCAGACTTTCCTTGG No data
1041659470_1041659473 -9 Left 1041659470 8:60387270-60387292 CCCCAACGCAGACACAATTCTTT 0: 1
1: 0
2: 3
3: 13
4: 157
Right 1041659473 8:60387284-60387306 CAATTCTTTCAGACTTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041659473 Original CRISPR CAATTCTTTCAGACTTTCCT TGG Intergenic
No off target data available for this crispr