ID: 1041659483

View in Genome Browser
Species Human (GRCh38)
Location 8:60387343-60387365
Sequence CAATTCTTTCAGACTTTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041659483_1041659486 23 Left 1041659483 8:60387343-60387365 CCAAGGAAAGTCTGAAAGAATTG No data
Right 1041659486 8:60387389-60387411 GTGTGTCCTCTAGCAGTCAGTGG 0: 1
1: 0
2: 3
3: 10
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041659483 Original CRISPR CAATTCTTTCAGACTTTCCT TGG (reversed) Intergenic
No off target data available for this crispr