ID: 1041662012

View in Genome Browser
Species Human (GRCh38)
Location 8:60410186-60410208
Sequence CATGCTCGCTGTTAAGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041662012_1041662020 16 Left 1041662012 8:60410186-60410208 CCACAGGCTTAACAGCGAGCATG No data
Right 1041662020 8:60410225-60410247 AAACTTACAATCAAGGTGGAAGG No data
1041662012_1041662021 21 Left 1041662012 8:60410186-60410208 CCACAGGCTTAACAGCGAGCATG No data
Right 1041662021 8:60410230-60410252 TACAATCAAGGTGGAAGGTGAGG No data
1041662012_1041662016 -7 Left 1041662012 8:60410186-60410208 CCACAGGCTTAACAGCGAGCATG No data
Right 1041662016 8:60410202-60410224 GAGCATGACTGGGCGGCCTCAGG No data
1041662012_1041662022 24 Left 1041662012 8:60410186-60410208 CCACAGGCTTAACAGCGAGCATG No data
Right 1041662022 8:60410233-60410255 AATCAAGGTGGAAGGTGAGGCGG No data
1041662012_1041662018 9 Left 1041662012 8:60410186-60410208 CCACAGGCTTAACAGCGAGCATG No data
Right 1041662018 8:60410218-60410240 CCTCAGGAAACTTACAATCAAGG 0: 5695
1: 8136
2: 6569
3: 4228
4: 2890
1041662012_1041662019 12 Left 1041662012 8:60410186-60410208 CCACAGGCTTAACAGCGAGCATG No data
Right 1041662019 8:60410221-60410243 CAGGAAACTTACAATCAAGGTGG 0: 17
1: 2828
2: 4092
3: 3362
4: 3330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041662012 Original CRISPR CATGCTCGCTGTTAAGCCTG TGG (reversed) Intergenic
No off target data available for this crispr