ID: 1041663101

View in Genome Browser
Species Human (GRCh38)
Location 8:60417768-60417790
Sequence TGTCCACTGATTATAGTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041663101_1041663102 -10 Left 1041663101 8:60417768-60417790 CCTAGCACTATAATCAGTGGACA No data
Right 1041663102 8:60417781-60417803 TCAGTGGACATAAATATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041663101 Original CRISPR TGTCCACTGATTATAGTGCT AGG (reversed) Intergenic
No off target data available for this crispr