ID: 1041663263

View in Genome Browser
Species Human (GRCh38)
Location 8:60419650-60419672
Sequence AGCCCCGTGTTTAAAGGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041663256_1041663263 18 Left 1041663256 8:60419609-60419631 CCTCTTAACTACCTGATTGGTTG No data
Right 1041663263 8:60419650-60419672 AGCCCCGTGTTTAAAGGTAGGGG No data
1041663259_1041663263 7 Left 1041663259 8:60419620-60419642 CCTGATTGGTTGGGTGTGAGCTG 0: 31
1: 72
2: 148
3: 116
4: 157
Right 1041663263 8:60419650-60419672 AGCCCCGTGTTTAAAGGTAGGGG No data
1041663255_1041663263 19 Left 1041663255 8:60419608-60419630 CCCTCTTAACTACCTGATTGGTT No data
Right 1041663263 8:60419650-60419672 AGCCCCGTGTTTAAAGGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041663263 Original CRISPR AGCCCCGTGTTTAAAGGTAG GGG Intergenic
No off target data available for this crispr