ID: 1041671635

View in Genome Browser
Species Human (GRCh38)
Location 8:60497559-60497581
Sequence GCTGGCAGTACTCACCATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041671632_1041671635 -8 Left 1041671632 8:60497544-60497566 CCTGATGGTGGCCATGCTGGCAG No data
Right 1041671635 8:60497559-60497581 GCTGGCAGTACTCACCATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041671635 Original CRISPR GCTGGCAGTACTCACCATGG CGG Intergenic
No off target data available for this crispr