ID: 1041675367

View in Genome Browser
Species Human (GRCh38)
Location 8:60533070-60533092
Sequence GTTATTTTACAAGCAAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 221}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041675367_1041675369 -2 Left 1041675367 8:60533070-60533092 CCAGTATTTGCTTGTAAAATAAC 0: 1
1: 0
2: 1
3: 22
4: 221
Right 1041675369 8:60533091-60533113 ACCGTACAAATACTAAATGGAGG No data
1041675367_1041675368 -5 Left 1041675367 8:60533070-60533092 CCAGTATTTGCTTGTAAAATAAC 0: 1
1: 0
2: 1
3: 22
4: 221
Right 1041675368 8:60533088-60533110 ATAACCGTACAAATACTAAATGG No data
1041675367_1041675371 6 Left 1041675367 8:60533070-60533092 CCAGTATTTGCTTGTAAAATAAC 0: 1
1: 0
2: 1
3: 22
4: 221
Right 1041675371 8:60533099-60533121 AATACTAAATGGAGGTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041675367 Original CRISPR GTTATTTTACAAGCAAATAC TGG (reversed) Intronic
900261530 1:1732832-1732854 GTTATGTTACCAGCAAGTATAGG - Intronic
906814421 1:48863839-48863861 GAAATTTTAGAAGTAAATACAGG + Intronic
907151852 1:52296383-52296405 GTTATTATCCAAGCAAAGATTGG + Intronic
907627237 1:56042127-56042149 TTTGTTTTATAAGAAAATACTGG + Intergenic
908066477 1:60411102-60411124 GTTAATTTAGAACTAAATACAGG - Intergenic
908329642 1:63058460-63058482 CTTGTTTTGCAAACAAATACTGG - Intergenic
909074145 1:71032978-71033000 ATTATTTTATAAGCAAATTTTGG + Intronic
910390331 1:86736431-86736453 GTTATTTTAATAGAATATACAGG + Intronic
912767574 1:112429139-112429161 GATATTTTACATGCAGATCCTGG + Intronic
912953142 1:114134408-114134430 GTCATTTAACAAGAAAGTACTGG + Intronic
914842339 1:151258759-151258781 TTTATTTTAAAAGAGAATACAGG - Intronic
915790176 1:158661064-158661086 TTTGTTTTACAAACAAATAGTGG + Intronic
916306847 1:163345752-163345774 GTTATATCAAAAGAAAATACAGG + Exonic
916398865 1:164423540-164423562 GTTATTTCCCAAGCCAAGACTGG - Intergenic
917824185 1:178799559-178799581 ATTATTTTACATCCAAAGACGGG - Intronic
918672271 1:187233471-187233493 ACTATTGTACAATCAAATACTGG + Intergenic
919040379 1:192379827-192379849 TTTATTTTAAATGCAAATAGTGG - Intergenic
919151315 1:193703441-193703463 GTTATTTTAAAGACAAATTCTGG + Intergenic
920318724 1:205100256-205100278 GTTAATTAAAAAGCAACTACGGG + Exonic
920454767 1:206091904-206091926 ATTATTCTACAAGCCAATACAGG - Intronic
923858533 1:237870061-237870083 GTTCTTTTTCAGGCAAATATAGG - Intergenic
1064857610 10:19787924-19787946 TTAATTTAACAACCAAATACAGG - Intronic
1068002794 10:51356028-51356050 GTTATTGTCATAGCAAATACAGG - Intronic
1069246484 10:66213373-66213395 AATATTTTAAAAGCAAATAGTGG + Intronic
1071428884 10:85588140-85588162 GACATTTTACAAGAAAATAAAGG + Intergenic
1071653095 10:87415597-87415619 GTAATCTTCCAAGCAAATATAGG + Intergenic
1073838515 10:107471519-107471541 GTTCTTTAATATGCAAATACAGG + Intergenic
1073875017 10:107913271-107913293 GTTATTTTAAAAGCTAATAATGG + Intergenic
1075352575 10:121737108-121737130 GTTATTTTACTAACAAAGCCAGG - Intergenic
1076410907 10:130249490-130249512 GCTATTTAACAAGAAAAGACTGG - Intergenic
1079295084 11:19225886-19225908 TTTATTTTACACACAAATACAGG + Intronic
1082264116 11:50101387-50101409 TTTATTTTACTAGCCATTACAGG + Intergenic
1087791655 11:102412127-102412149 GGTATATTAAAAGCAAATAGAGG + Intronic
1088726467 11:112640977-112640999 GTGTTGTTACAAGAAAATACTGG - Intergenic
1092786800 12:12033682-12033704 GTTTTTTTCCATGCAAAGACAGG - Intergenic
1093791825 12:23260456-23260478 GTTATTTAAAAAGGAAAAACAGG + Intergenic
1095168241 12:39001060-39001082 GTAATTTTAAAGACAAATACAGG + Intergenic
1097393966 12:59050884-59050906 TTTATTTTCCAACCACATACAGG + Intergenic
1100063504 12:90610986-90611008 GATATTTTAAAAACTAATACAGG - Intergenic
1100262579 12:92947007-92947029 GTTATTTTAAAAGGAAAAATGGG + Intergenic
1100921707 12:99495668-99495690 ATTATTTTACACACAAATACTGG - Intronic
1105455866 13:20540799-20540821 TTTATTTTTCAAGCCAATACAGG + Intergenic
1106486716 13:30179184-30179206 GTTATTTTGCAGGCAAAACCTGG + Intergenic
1107596824 13:41971869-41971891 GTTACTTTACATGTAAATATGGG - Intergenic
1108343925 13:49525606-49525628 GTTATTTTACAAGGACAAGCTGG + Intronic
1108888037 13:55214366-55214388 GTCATTTTAAAATCAATTACTGG + Intergenic
1109172216 13:59110979-59111001 TTTATTTTAAAAGCAATTAATGG - Intergenic
1109902208 13:68789006-68789028 GTTATTTTAAAAGTTAATACAGG - Intergenic
1110038643 13:70721346-70721368 GTTATTTTACAAGTAGAAAGTGG - Intergenic
1111196691 13:84883727-84883749 GTTATCTTGCAAGAAAATAAGGG + Intergenic
1111469796 13:88664367-88664389 TTTATTTTGCAACCAAATATTGG + Intergenic
1111473288 13:88714410-88714432 ATTATTTTAGAAGAAAATATAGG + Intergenic
1112173361 13:96995685-96995707 GTTATTTGAAAAACAAGTACTGG + Intergenic
1113003546 13:105672308-105672330 GTTAAGTTAGAAGCAGATACAGG + Intergenic
1115087654 14:29536488-29536510 GTTATTTTTAAAGCAAATATAGG - Intergenic
1115221536 14:31062994-31063016 TTTATGTTATAAGCAAATATTGG + Intronic
1115400799 14:32957829-32957851 GTGATTTTACCACCAAATTCAGG - Intronic
1115614379 14:35079763-35079785 GCTATTCTTCAAGCAAATAGAGG + Intronic
1115627653 14:35210270-35210292 GTTTTTTGACAAGTAATTACTGG - Intronic
1116225346 14:42143917-42143939 GTATTTTTACATACAAATACAGG - Intergenic
1116839240 14:49802772-49802794 TTTGTTTTACAAGCAAAAAATGG - Intronic
1116915044 14:50516786-50516808 GTTATCTTACAAACCAAAACTGG - Intronic
1117629285 14:57672569-57672591 GTTATTTTATAATCATATAGCGG - Intronic
1118661318 14:68016183-68016205 GGCTTTTTATAAGCAAATACGGG + Intronic
1119047434 14:71331755-71331777 GCTATTCAACAAGCAGATACAGG - Intronic
1119081441 14:71698117-71698139 TTTATTTCAGAAGCAAATGCTGG - Intronic
1119597897 14:75953517-75953539 GTTTTTTTAAAAGCAAACAAGGG + Intronic
1119629786 14:76219028-76219050 GTTATTTTATAACCTAAGACTGG + Intronic
1123132267 14:105998234-105998256 GATATTTAAAAAGTAAATACTGG - Intergenic
1123461946 15:20480625-20480647 TTTAATTTATAAACAAATACTGG + Intergenic
1123582488 15:21729350-21729372 GATATTTAAAAAGTAAATACTGG - Intergenic
1123619138 15:22171946-22171968 GATATTTAAAAAGTAAATACTGG - Intergenic
1123656110 15:22519761-22519783 TTTAATTTATAAACAAATACTGG - Intergenic
1124272632 15:28296608-28296630 TTTAATTTATAAACAAATACTGG + Intronic
1124310020 15:28614933-28614955 TTTAATTTATAAACAAATACTGG - Intergenic
1124953087 15:34341355-34341377 GTTATACAAAAAGCAAATACTGG + Intergenic
1125170409 15:36760539-36760561 GTTATTTTAGAGGCAAAGAAAGG + Intronic
1127888669 15:63227666-63227688 ATTATTTTAAAAACAAATCCAGG - Intronic
1128460845 15:67865774-67865796 GTTATTTTAACAGCAAAAATTGG - Intergenic
1130767710 15:86888972-86888994 GTTATATAACAAGTAAAGACTGG + Intronic
1131671624 15:94625965-94625987 GTTAGTGTTCTAGCAAATACTGG + Intergenic
1133916731 16:10115764-10115786 TTCATTTCTCAAGCAAATACTGG + Intronic
1135615297 16:23906378-23906400 GTTCTTTCACAAACAAAAACCGG - Intronic
1136482959 16:30554177-30554199 GATATTTTACAACCAAATACAGG - Exonic
1136501449 16:30671707-30671729 GTTATTTTTCTAGCTACTACAGG + Intergenic
1137087428 16:36143969-36143991 GTTATTTTAAAATAAAATAGTGG - Intergenic
1138074535 16:54027965-54027987 TTTATTTTACTAGCAACTTCTGG + Intronic
1202995984 16_KI270728v1_random:110793-110815 ATTATTTTAATAGCAAATATTGG + Intergenic
1203022671 16_KI270728v1_random:423135-423157 ATTATTTTAATAGCAAATATTGG + Intergenic
1143304760 17:5937583-5937605 GTTATATTACAACAAAAGACGGG + Intronic
1144351269 17:14399302-14399324 GTTATTTTAAAAGGAAATATTGG + Intergenic
1149771383 17:59324553-59324575 GTTATTTTAAAAATAAATTCTGG - Intergenic
1150564078 17:66322818-66322840 TTTATTTTACAATGAAATTCAGG - Intronic
1155945536 18:31845828-31845850 GTTATTTAAAAACAAAATACAGG + Intronic
1156590611 18:38483505-38483527 TTTATCTTGCAAGCAATTACTGG + Intergenic
1157342925 18:46795365-46795387 GTTATTTTTAAAGTAAAAACTGG + Intergenic
1157704604 18:49793340-49793362 GTTGTTTTAAAACCAAATAAGGG - Intronic
1157996543 18:52564309-52564331 GTTATTTTGAAAGAAATTACTGG + Intronic
1159244323 18:65785431-65785453 GTCATTTTTGAGGCAAATACTGG + Intronic
1159624553 18:70676819-70676841 ATTATTTTAAAAGGAAATATTGG - Intergenic
1160330555 18:77987657-77987679 CTTAGTTTACTTGCAAATACAGG + Intergenic
1160487214 18:79304555-79304577 CCTGTTTTAAAAGCAAATACAGG - Intronic
1164913748 19:32033189-32033211 ATTATTTCAAAACCAAATACAGG + Intergenic
1165246534 19:34501189-34501211 GTTATTTTTAAAGCAAATGCCGG + Exonic
1167214123 19:48152894-48152916 GTTATTTAAGAACAAAATACAGG + Intronic
1167484408 19:49753123-49753145 GTTTTTTAAAAAGCAACTACAGG + Intronic
926677211 2:15635925-15635947 GATACTTTAAAAGAAAATACCGG + Intergenic
927364365 2:22276806-22276828 GTTACCTTACAGGCAGATACGGG + Intergenic
930447622 2:51495229-51495251 TGTATTTTACAAGCAACAACTGG + Intergenic
930576276 2:53153317-53153339 GTTATGTTACAAGCAAGTTTAGG + Intergenic
931099518 2:58980399-58980421 GTTGTTTTAAAATCAAATAGGGG - Intergenic
931559364 2:63541593-63541615 GTTATTAAACCAGCAAATGCTGG + Intronic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
932391903 2:71399546-71399568 GTACTTTTACAAGCAAAATCTGG + Exonic
936457652 2:112687583-112687605 TTTTTTTGAAAAGCAAATACTGG + Intergenic
936757028 2:115726682-115726704 GTGATTTAACAAGCATTTACAGG - Intronic
937473465 2:122193288-122193310 GTTATTTTACAAAAAACTCCAGG + Intergenic
939732550 2:145802728-145802750 ATTACTTTAAAAGAAAATACTGG + Intergenic
939769671 2:146299533-146299555 GTTCTTTTACAAGTAAATCAGGG - Intergenic
939821935 2:146968367-146968389 ATAATTTTAAAAGCAAATAAAGG - Intergenic
940419787 2:153466735-153466757 GTTGTTTTAGACTCAAATACAGG + Intergenic
940430240 2:153581375-153581397 GTTATTTTATTAGCAAATAGGGG + Intergenic
940436434 2:153661597-153661619 GTTATTTTCCATGAAGATACGGG + Intergenic
940466578 2:154037072-154037094 GTTATTTTAAAAGGAATTAAAGG + Intronic
941621538 2:167784443-167784465 GTTATTTTTCAAGAGTATACTGG + Intergenic
943138423 2:183945871-183945893 CTCATATTACAATCAAATACTGG + Intergenic
944720971 2:202422976-202422998 ATTATTTTAAAAGAATATACAGG - Intronic
1169108536 20:3018109-3018131 GTTGTTTGACTACCAAATACAGG - Intronic
1174101557 20:48130178-48130200 TTTATTTTAAAATCAAACACAGG - Intergenic
1174533244 20:51231276-51231298 GTTGTTTTACAAGCAATTTGGGG + Intergenic
1176920981 21:14687123-14687145 TTTATTTTGCAAGCACATACAGG - Intergenic
1177126185 21:17195548-17195570 CTTATTTTGCCAGAAAATACAGG + Intergenic
1179339637 21:40492546-40492568 TTTTTTTTAAAAGCAAATTCTGG + Intronic
1181136676 22:20771880-20771902 GTTATTTTTAAAGCCAGTACCGG - Intronic
1182601209 22:31465738-31465760 GTTATTTAACAGTCAAAAACTGG + Intronic
949703772 3:6791309-6791331 GTTATTTTAAGTGCAAATACAGG + Intronic
951064703 3:18250362-18250384 GATATTATATAAGCAAAGACAGG - Intronic
951689329 3:25379255-25379277 GTTATTTTCTAATCAAATGCAGG + Intronic
952198178 3:31097915-31097937 GTTATTTTCCTGGCAAATTCTGG - Intergenic
952623898 3:35380777-35380799 ATTATTTTACATGAATATACAGG + Intergenic
957464924 3:80575847-80575869 TTTATTTTGCAATCAAATATGGG - Intergenic
958009505 3:87858610-87858632 TTAATTTTACAAGCAATTACAGG - Intergenic
959294406 3:104517268-104517290 AATATTTTAGAAGCAAATACAGG + Intergenic
960384707 3:117008429-117008451 GTTATTTAAAAAGAAAATTCTGG + Intronic
960546989 3:118926686-118926708 GTTACTTTACAAACAAAAACTGG + Intronic
961778373 3:129306334-129306356 GTGATGTTAGAAGCAAATCCTGG + Intergenic
964973752 3:162593861-162593883 CTTTTTATACAAACAAATACAGG - Intergenic
964994613 3:162861593-162861615 ATTATTTTATGTGCAAATACTGG + Intergenic
965101034 3:164298076-164298098 ATTATTTTAAAAGCAGATAAAGG - Intergenic
966157044 3:176927792-176927814 CTTATTTTATAAGGAGATACAGG - Intergenic
966553934 3:181237057-181237079 GTTATTTTATAAGGAAATAAGGG - Intergenic
966955468 3:184873310-184873332 GTTATTTTAAGAGCAAGCACAGG + Intronic
970725022 4:19033688-19033710 GTCATTTTTGAAGCAAATAAAGG + Intergenic
972831446 4:42818708-42818730 TTAATTATACAAGCAAATAAGGG - Intergenic
973085749 4:46057643-46057665 GTTATTCTACAGGCAACTACAGG + Intronic
973903470 4:55502023-55502045 GTTATTTTACGTGTAAAAACAGG - Intronic
974092892 4:57330720-57330742 CTTATTTTACAACCAAGTATGGG - Intergenic
974164456 4:58183662-58183684 ATTATTTTAAAAGCAAATATAGG - Intergenic
974349487 4:60725723-60725745 TTTATTTAATAAGCAAATAAAGG + Intergenic
974694598 4:65349502-65349524 GTCTTTTTACAAGAAAATATTGG - Intronic
974822608 4:67086377-67086399 ATTATTTTACTGGAAAATACTGG - Intergenic
975882142 4:78922897-78922919 GTTCTCAAACAAGCAAATACAGG + Intronic
975989615 4:80243926-80243948 GATATTTTACCATCAAATTCTGG + Intergenic
976029287 4:80731421-80731443 GTTATTTTACAAGCCATTATTGG - Intronic
977869723 4:102077140-102077162 GTTATTTTCCAAGGAATTAATGG + Intergenic
978518327 4:109593312-109593334 GTTACTTTACAACCAAAGACTGG - Intronic
979563473 4:122126810-122126832 GTTATTTCACTATCAAAAACAGG + Intergenic
980643401 4:135609521-135609543 GATATGTTAGAAGCAAAGACAGG + Intergenic
980674853 4:136064568-136064590 GTAAATTTACAAGAAAATAGAGG + Intergenic
983999378 4:174222159-174222181 ATTATTTCAAAAGCAAATGCTGG - Intergenic
987046218 5:14111449-14111471 GTTATTTTAGATTCAAATATTGG + Intergenic
988848373 5:35153549-35153571 ATTATATAACAAGCAAATAGAGG + Intronic
989293869 5:39800730-39800752 GTTATTTTAAAAGGTAATGCAGG - Intergenic
990729090 5:58788710-58788732 GTTCTTTTCTAAGTAAATACTGG + Intronic
991404370 5:66287676-66287698 TTTATTTTACAATCAAAGATGGG - Intergenic
991724373 5:69521163-69521185 GTTATTTTAAAACCAAAAATAGG + Intronic
993541864 5:89161729-89161751 GTTATTTACCAAGTAAATTCAGG - Intergenic
994600424 5:101895596-101895618 GTTATTTTACATGGCATTACTGG + Intergenic
994716951 5:103333354-103333376 GATAAGTGACAAGCAAATACTGG + Intergenic
994888404 5:105597380-105597402 GTACTTTTAAAAGCAAATATTGG + Intergenic
996221816 5:120942086-120942108 GTTTTTTTCCAGGGAAATACAGG + Intergenic
996864659 5:128106659-128106681 TTTATTTTAAAATAAAATACTGG + Intronic
1000729696 5:164818053-164818075 GTTATTATATATGCAAATAATGG + Intergenic
1000868565 5:166546593-166546615 TTTATTTTAAAAACAAATATTGG + Intergenic
1000978866 5:167795020-167795042 TTTATTTTACAAACAAAATCAGG + Intronic
1003779885 6:9412701-9412723 ATTATTTTAAAAGGAAATTCTGG - Intergenic
1004622053 6:17339542-17339564 TTTATTTTAAAAGGAAATGCTGG + Intergenic
1006247403 6:32750607-32750629 GTTATCATACAGGCACATACTGG - Intergenic
1009536557 6:64895865-64895887 ATTATTTTAAAAGGAAATATAGG + Intronic
1011802444 6:91032312-91032334 GTTATTTTAAAATCATATATTGG + Intergenic
1012558812 6:100552462-100552484 CTTATATTACAAGCACATATTGG - Intronic
1013227358 6:108129571-108129593 GTTATTTTAAAAGGGAATATGGG + Intronic
1013469625 6:110450309-110450331 ATTATTTTAAAAGCATTTACCGG + Intronic
1013875180 6:114817040-114817062 GACATATAACAAGCAAATACTGG + Intergenic
1014421766 6:121254738-121254760 CTTATTTTATAATCAAATATTGG - Intronic
1014847169 6:126291679-126291701 TTTGTTTTAGAAGCAAATAAAGG - Intergenic
1015703095 6:136057565-136057587 TTTAGTTGACAACCAAATACTGG - Intronic
1016163937 6:140916584-140916606 TTTATTTAACAAGCACACACAGG - Intergenic
1016224802 6:141722267-141722289 TTTATTCTATCAGCAAATACAGG - Intergenic
1017473947 6:154769174-154769196 GTTACTATTCAAGGAAATACTGG - Intronic
1018201673 6:161401156-161401178 GATACTTTACATGCAAAAACAGG - Intronic
1018896375 6:168020899-168020921 GCTATTTTAAAAACAAATAAAGG + Intronic
1019441897 7:1051671-1051693 GTTATTTAAAAAACAAAAACAGG + Intronic
1020655107 7:10919874-10919896 GTTATTTTATAAGCACCTAAGGG - Intergenic
1020777782 7:12476819-12476841 GTTTTTTTCTAAGCAAATAGTGG + Intergenic
1021029946 7:15719993-15720015 TTTATGTTAAAAGCAAATAAGGG - Intergenic
1021086360 7:16424693-16424715 TTTATTTTAAAAGTCAATACTGG - Intergenic
1021204087 7:17758556-17758578 GCTATTTTAAAAGCTAATACAGG + Intergenic
1022755366 7:33282113-33282135 GCTATTTTAAAAACAAATAAGGG - Intronic
1023658284 7:42448208-42448230 TTTATTTTATATGCAAATGCCGG - Intergenic
1029840354 7:103356123-103356145 GTTTCTTTGCATGCAAATACAGG - Intronic
1030253090 7:107471260-107471282 GTTATTTTGATAACAAATACTGG + Intronic
1030258855 7:107542010-107542032 GTAAATTTACAAGCAATTTCAGG + Intronic
1030298327 7:107951090-107951112 TTTATTTTGCAATTAAATACAGG + Intronic
1034228197 7:149498466-149498488 GTTATTTTTAAAACAAAGACAGG - Intergenic
1037443340 8:18939804-18939826 GTGATTTTACAAGCCACTAATGG - Intronic
1038126217 8:24675655-24675677 ATTTATTTTCAAGCAAATACAGG - Intergenic
1038728522 8:30104287-30104309 TTTCTTTTTCTAGCAAATACTGG + Exonic
1039144468 8:34430918-34430940 GTCATTTTAAAATCAAATATAGG - Intergenic
1041675367 8:60533070-60533092 GTTATTTTACAAGCAAATACTGG - Intronic
1042114470 8:65415578-65415600 GTTTTTTTACAATAAACTACAGG + Intergenic
1042998642 8:74730560-74730582 CTTATCTTACAGGCAAAAACTGG - Intronic
1044271750 8:90252911-90252933 GTTATTTTATAAGAAGAAACTGG - Intergenic
1045845186 8:106626197-106626219 TTTTTTTTACAAGGAAAAACAGG - Intronic
1052039988 9:23727349-23727371 GTTTTTTTATAAGCAAAGGCTGG + Intronic
1052382489 9:27786398-27786420 CTTATTTTGCTACCAAATACTGG - Intergenic
1052669992 9:31544760-31544782 AATATTTTACAATAAAATACAGG + Intergenic
1053521849 9:38788520-38788542 GTGATTTTAAAAACACATACAGG - Intergenic
1054194016 9:62012508-62012530 GTGATTTTAAAAACACATACAGG - Intergenic
1054644391 9:67576183-67576205 GTGATTTTAAAAACACATACAGG + Intergenic
1055011218 9:71567909-71567931 GTTATTTTAAAATCAAATTTAGG - Intergenic
1056433706 9:86554501-86554523 GTTATTTTAAAAGTAATTTCTGG - Intergenic
1061471795 9:130832816-130832838 ATTCTGTTACAAGCAAATAAAGG - Intronic
1187834372 X:23416314-23416336 CTTATTTTTAAAGCAAAAACTGG + Intergenic
1187970950 X:24657751-24657773 GTTATTCTATAAGCAATTATAGG + Intronic
1193718672 X:84962200-84962222 GACATTTTACAAGTAAATATCGG - Intergenic
1193965230 X:87976490-87976512 CTTATTTTACAAGCTCATAGGGG + Intergenic
1197747637 X:129942918-129942940 TTTATTTTTTAAGCAAATACTGG + Intergenic
1197913155 X:131507399-131507421 GTTATTTTAAAAAAGAATACAGG - Intergenic
1199287720 X:146072431-146072453 CTTATTTTACAAACATTTACTGG - Intergenic
1199479898 X:148286707-148286729 TGTATTTTACAAGCAATTAGAGG + Intergenic
1202270524 Y:23068089-23068111 GTAATGTTACAAGCAAAAATAGG + Intergenic
1202295503 Y:23352593-23352615 GTAATGTTACAAGCAAAAATAGG - Intergenic
1202423518 Y:24701833-24701855 GTAATGTTACAAGCAAAAATAGG + Intergenic
1202447271 Y:24968252-24968274 GTAATGTTACAAGCAAAAATAGG - Intergenic