ID: 1041676556

View in Genome Browser
Species Human (GRCh38)
Location 8:60545685-60545707
Sequence CGACCCTGAGTAAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041676553_1041676556 -2 Left 1041676553 8:60545664-60545686 CCTACTGAGGGACAGTGACTCCG No data
Right 1041676556 8:60545685-60545707 CGACCCTGAGTAAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041676556 Original CRISPR CGACCCTGAGTAAAGGAAGA AGG Intronic