ID: 1041678713

View in Genome Browser
Species Human (GRCh38)
Location 8:60564288-60564310
Sequence TACCCACAGCACCAAGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 261}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041678713_1041678717 -2 Left 1041678713 8:60564288-60564310 CCTTTCCCTTGGTGCTGTGGGTA 0: 1
1: 0
2: 0
3: 18
4: 261
Right 1041678717 8:60564309-60564331 TAAACTTAAGTTCTTAGCCAGGG No data
1041678713_1041678716 -3 Left 1041678713 8:60564288-60564310 CCTTTCCCTTGGTGCTGTGGGTA 0: 1
1: 0
2: 0
3: 18
4: 261
Right 1041678716 8:60564308-60564330 GTAAACTTAAGTTCTTAGCCAGG No data
1041678713_1041678718 9 Left 1041678713 8:60564288-60564310 CCTTTCCCTTGGTGCTGTGGGTA 0: 1
1: 0
2: 0
3: 18
4: 261
Right 1041678718 8:60564320-60564342 TCTTAGCCAGGGCCTACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041678713 Original CRISPR TACCCACAGCACCAAGGGAA AGG (reversed) Intronic
900422334 1:2560998-2561020 CACCCACAGCCCCAGGGGACAGG - Intronic
901629102 1:10639628-10639650 CACCGACAGCACCAAGGTCACGG - Exonic
903184881 1:21623162-21623184 TGGCCACAGCACCTAGGGAGGGG + Intronic
904323709 1:29713207-29713229 TATGCAGAGCACCATGGGAAGGG + Intergenic
904987651 1:34565136-34565158 TACCCACATCACCCATGGCAGGG + Intergenic
907407924 1:54265152-54265174 CACCCACAGCCCCCAAGGAAAGG + Intronic
907413369 1:54297784-54297806 TACCCATAAAACAAAGGGAATGG + Intronic
908435754 1:64104258-64104280 TGCCCACAGCACCTAGGGTGTGG - Intronic
908646920 1:66288274-66288296 CAAACACACCACCAAGGGAATGG + Intronic
910291755 1:85606398-85606420 TTCCAACAGAAACAAGGGAAGGG - Intergenic
912667960 1:111599886-111599908 TTCACTCATCACCAAGGGAATGG - Intronic
913594908 1:120366020-120366042 TACCCAAAGCTCCAGTGGAAAGG + Intergenic
914092360 1:144512966-144512988 TACCCAAAGCTCCAGTGGAAAGG - Intergenic
914306172 1:146420905-146420927 TACCCAAAGCTCCAGTGGAAAGG + Intergenic
914595880 1:149151904-149151926 TACCCAAAGCTCCAGTGGAAAGG - Intergenic
916210770 1:162357912-162357934 TACCACCAGCACTCAGGGAATGG + Intronic
916370438 1:164088236-164088258 TGCACCCAGCAACAAGGGAAGGG + Intergenic
917598759 1:176555151-176555173 TACCCACCTCACCAAGGCACAGG - Intronic
919068205 1:192720603-192720625 TACTGAAAGCACCAAGAGAAAGG + Intergenic
919804879 1:201375645-201375667 TACCCAAAGCCCCAGGGGAGCGG + Intronic
922329398 1:224560835-224560857 TTCCCACAGACCCAGGGGAATGG - Intronic
922468849 1:225862918-225862940 TGCCCACGGATCCAAGGGAAAGG + Intronic
922479328 1:225928130-225928152 TGGCCACAGCACCAAGGAAATGG - Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924422683 1:243924207-243924229 TACCCACAGCACAAAAGGGCTGG - Intergenic
924452311 1:244189479-244189501 TGACCACAGCACCAAGGGGATGG - Intergenic
1063123403 10:3120445-3120467 TACCCTCAGCATCAAGGCAGGGG - Intronic
1063174728 10:3540936-3540958 TTCCCACAGCAACAAGGGCTGGG - Intergenic
1064193714 10:13228838-13228860 TCCCCACAGCCCCAAGCCAATGG + Intronic
1066447381 10:35496023-35496045 TACCCACAGGAAAAAGGAAAGGG + Intronic
1067919071 10:50434536-50434558 TACCCAAAGCATAAAGGGACAGG + Intronic
1068266698 10:54658913-54658935 TATCCACAGCCCCAAAGTAAAGG + Intronic
1074217409 10:111399206-111399228 GAATCACAGTACCAAGGGAACGG - Intergenic
1075055929 10:119218301-119218323 TACCCACTCCAGGAAGGGAAGGG + Intronic
1076419740 10:130322574-130322596 TTCACTCATCACCAAGGGAATGG + Intergenic
1076438739 10:130464551-130464573 TACCCACTCCACCAGAGGAAAGG - Intergenic
1077058008 11:605339-605361 TGCCCACAGCCCCCAGGGAGAGG - Intronic
1080048367 11:27833570-27833592 TACCTCCAGGACCTAGGGAATGG + Intergenic
1080173841 11:29338656-29338678 TGACAACAGCACCAAGGGAATGG + Intergenic
1083444012 11:62695172-62695194 TACCAACAGAACCAAGATAAGGG - Intronic
1084701083 11:70786444-70786466 TACCAACAGCACTGATGGAATGG - Intronic
1085344973 11:75762849-75762871 TACCCACAGCACCCAGCACAAGG + Intronic
1085660705 11:78363957-78363979 TACCCACAGACCTAAGGGAAAGG + Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1088661589 11:112052765-112052787 TACCCACTGACCTAAGGGAAAGG - Intronic
1088917922 11:114241062-114241084 TACCCAGAACACCAGGTGAATGG - Intronic
1088989302 11:114937944-114937966 TAAAAACAGCACCAAGGGGATGG - Intergenic
1089752392 11:120660928-120660950 GTCCCACAGCAACAAGGCAAGGG - Intronic
1090224040 11:125057974-125057996 TAGCCACAGGACCAAGGAAGGGG - Intergenic
1090332351 11:125941935-125941957 AACCCACAGCACAAAAGGAGGGG + Intergenic
1091322271 11:134660118-134660140 AACTCACATCACCAAGGGGATGG - Intergenic
1092929298 12:13300265-13300287 AAACCACAGAACCAAGGAAAAGG + Intergenic
1093612986 12:21184883-21184905 TACCCACAGGATCAAAGTAAAGG + Intronic
1094027600 12:25975323-25975345 TACCCACCCCACCAGGGTAAAGG + Intronic
1094038506 12:26097155-26097177 TACCCCCAGGGCCAAGTGAATGG - Intergenic
1097895688 12:64822957-64822979 CACCCACAGCACCCAGGTTATGG - Intronic
1098611361 12:72462449-72462471 TACCAACACCACCCAGGAAAGGG - Intronic
1099343089 12:81463563-81463585 TACCCTCAGCACGAAGGGAGGGG + Intronic
1102586280 12:113925244-113925266 TACACACAGAGCCCAGGGAAAGG + Intronic
1103926153 12:124424473-124424495 TGCCCACAGCACCGAGTGAGTGG - Intronic
1105551067 13:21396182-21396204 TACTCACAGCGCCAAGAGGAAGG - Intronic
1106483130 13:30151460-30151482 CACCCTCAGCACCATGGGACAGG + Intergenic
1108623520 13:52206170-52206192 TTCCCACAGCCCCAAGGGGATGG + Intergenic
1111064747 13:83075171-83075193 TACCCACAGGCTCAAAGGAAAGG + Intergenic
1111264425 13:85789362-85789384 TACTTACAACACCAAGGAAATGG + Intergenic
1111802381 13:92996624-92996646 AAACCATAGCACCATGGGAAAGG - Intergenic
1113350182 13:109521911-109521933 AACCCAAAGCGCCAAGGGAGCGG - Intergenic
1113901517 13:113800757-113800779 CACCCACCCCACCAAGGGCAGGG - Intronic
1115376172 14:32678391-32678413 TACCAGCAGCAGCAAGCGAAAGG + Exonic
1117191050 14:53292223-53292245 TGACCACAGCACCAAGAGAGTGG - Intergenic
1117821809 14:59657771-59657793 TACCTACAGCACCAGGGCCATGG + Intronic
1118424990 14:65650898-65650920 TAGCTACAGCACCTGGGGAAGGG - Intronic
1121743059 14:96267378-96267400 TCCCCACAGCTGCACGGGAAGGG + Intronic
1122721565 14:103725256-103725278 CACCCTCAGCACCAAAGGCACGG - Intronic
1202845425 14_GL000009v2_random:168620-168642 AACTCAGAGCTCCAAGGGAATGG - Intergenic
1202914825 14_GL000194v1_random:158886-158908 AACTCAGAGCTCCAAGGGAATGG - Intergenic
1202875366 14_GL000225v1_random:202599-202621 AACTCAGAGCTCCAAGGGAATGG + Intergenic
1202877844 14_KI270722v1_random:23823-23845 AACTCAGAGCTCCAAGGGAATGG + Intergenic
1123666355 15:22611791-22611813 TGCCCAAAGCACAAGGGGAAAGG + Intergenic
1123771924 15:23537627-23537649 TAGCCTCAGCACCAAGGTAGGGG - Intergenic
1124082785 15:26516962-26516984 CTACCACAGCACTAAGGGAATGG - Intergenic
1124320174 15:28706205-28706227 TGCCCAAAGCACAAGGGGAAAGG + Intronic
1124482338 15:30089212-30089234 TGCCCAAAGCACAAGGGGAAAGG - Intronic
1124488796 15:30141314-30141336 TGCCCAAAGCACAAGGGGAAAGG - Intronic
1124537420 15:30558223-30558245 TGCCCAAAGCACAAGGGGAAAGG - Intronic
1124543879 15:30610278-30610300 TGCCCAAAGCACAAGGGGAAAGG - Intronic
1124600284 15:31128118-31128140 TAACCACAGCACACAGGGTAAGG + Intronic
1124754732 15:32397009-32397031 TGCCCAAAGCACAAGGGGAAAGG + Intronic
1124761236 15:32449364-32449386 TGCCCAAAGCACAAGGGGAAAGG + Intronic
1124777398 15:32599699-32599721 TGCCCAAAGCACAAGGGGAAAGG - Intronic
1126866653 15:52944302-52944324 CAGCCACAGCACCATGGAAAGGG + Intergenic
1130886254 15:88095011-88095033 TAGCCACAGCTCCCAGGTAATGG - Intronic
1134332444 16:13263389-13263411 CAAGAACAGCACCAAGGGAATGG - Intergenic
1136552172 16:30987634-30987656 TCCCCACAGCAGCCTGGGAAAGG - Intronic
1137919847 16:52476150-52476172 TACCCATATCACCAGGAGAAAGG + Intronic
1138007882 16:53354791-53354813 GCCCCCCAGCCCCAAGGGAATGG + Intergenic
1138479413 16:57292085-57292107 TTCCCACAGCACCAAGCATAGGG - Intergenic
1140032298 16:71348474-71348496 CACCCACAGCAGCCGGGGAATGG + Intergenic
1140677257 16:77344687-77344709 AAGCCACAGAACCAAGAGAAGGG + Intronic
1141523446 16:84596625-84596647 TTCCCACGGCACCCAGGGCATGG + Intronic
1141657807 16:85425338-85425360 CACCCCCAGGGCCAAGGGAAAGG + Intergenic
1141682479 16:85552765-85552787 TCCCCACTGCAGCAGGGGAAGGG + Intergenic
1142144036 16:88485255-88485277 TCCCCCCAGCACCAGGGGACAGG - Intronic
1143881789 17:10035506-10035528 TTCCCACAGTGCCAGGGGAAGGG - Intronic
1144781798 17:17811998-17812020 CTCCCCCAGCACCTAGGGAAAGG - Intronic
1145259266 17:21345084-21345106 TACCCACAGGACCAATGGAGAGG - Intergenic
1145317350 17:21742864-21742886 TACCCACAGGTCCAATGGAGAGG + Intergenic
1146432593 17:32811712-32811734 TATCCCCAGCTCCAAGAGAATGG + Intronic
1146500840 17:33363229-33363251 CACCCACAGAACCAGGGGCAGGG + Intronic
1147323271 17:39658558-39658580 TACCCACAGCCCCAAGAGAGGGG + Intronic
1147331384 17:39701121-39701143 CACGCACAGCACCAAGGAAAAGG - Intronic
1149443940 17:56699272-56699294 CACACACAGCCCCAAGGGACCGG + Intergenic
1150574078 17:66414260-66414282 CACTCACAGCACCAAGGTGATGG - Intronic
1151538045 17:74749580-74749602 CACCCACAGACCCGAGGGAAGGG - Intronic
1151924671 17:77186262-77186284 GACCCACAGCCCCCAGGGGAGGG - Intronic
1153474470 18:5483075-5483097 TACCTACAGCAACCAGTGAAGGG + Intronic
1155058792 18:22210196-22210218 AGCCCACAGCACCAAGGTCATGG - Intergenic
1160063261 18:75550999-75551021 TATCCTCAGCACCAACAGAAGGG - Intergenic
1160288993 18:77572781-77572803 TGCCCACACCACCAAGGTCAGGG + Intergenic
1161076719 19:2289515-2289537 GCCCCACAGCCCCAAGGGGAGGG - Intronic
1161307061 19:3574056-3574078 GGCCCACAGGACCAAGGGGAGGG - Intronic
1162180400 19:8865156-8865178 TCCCCAAACCACCAAGGGGAGGG - Intronic
1168633442 19:57975314-57975336 GACCCACAGCAGGAAGGTAAAGG + Intergenic
1168703287 19:58454027-58454049 TGCCCAGAGCACCAAAGCAACGG - Intronic
1168705767 19:58469523-58469545 TGCCCAGGGCACCAAAGGAAGGG - Intronic
1202672834 1_KI270710v1_random:9120-9142 AACTCAGAGCTCCAAGGGAATGG - Intergenic
925603602 2:5635366-5635388 TACCCAAAGCTCCAGTGGAAAGG + Intergenic
926156470 2:10456993-10457015 TACGCACAGCACCAAGGCTGTGG + Intergenic
926184051 2:10674436-10674458 TACCCACACTCTCAAGGGAAGGG - Intronic
926336750 2:11869004-11869026 CTCCCACAGCACCGAGGGAAAGG + Intergenic
927288036 2:21377423-21377445 TACCCATAGAACCAAAGGCAGGG - Intergenic
928134583 2:28678660-28678682 GGCCCACAGCACCAAGGACACGG + Intergenic
933403353 2:81826967-81826989 TAAAGACAGCACCAAGGGGATGG - Intergenic
936035769 2:109109936-109109958 TCAGCACAGAACCAAGGGAAAGG - Intergenic
936270404 2:111044415-111044437 TACCCATAGCCCCATGGGCAGGG + Intronic
937258854 2:120572813-120572835 TATCCACCGCACCAAGGAGAAGG + Intergenic
938064811 2:128275989-128276011 TACTCACAACACCATGGGAAAGG + Intronic
939021373 2:136961800-136961822 TAATCACATCAGCAAGGGAATGG + Intronic
942123502 2:172801587-172801609 AAACCACAGCACTAAGGGGAGGG - Intronic
942498751 2:176566039-176566061 AACCCATGGCAACAAGGGAAGGG + Intergenic
943424071 2:187707365-187707387 GACCAACAGTACCAAGGGGATGG - Intergenic
1169388773 20:5172828-5172850 TACCCAAAGTATCAAGGGACAGG - Intronic
1169934651 20:10870605-10870627 TACCTACAGAGCCCAGGGAACGG + Intergenic
1171497943 20:25570348-25570370 TGACAACAGCACCAAGGGGATGG - Intronic
1171515212 20:25726134-25726156 CAAGAACAGCACCAAGGGAATGG - Intergenic
1172266923 20:33623921-33623943 TACAAACAGCATCAAGGAAAAGG - Intronic
1174511967 20:51060206-51060228 CACCCACAGGACCTAGGGATGGG + Intergenic
1174715649 20:52755165-52755187 TGAGAACAGCACCAAGGGAATGG + Intergenic
1176634176 21:9173531-9173553 AACTCAGAGCTCCAAGGGAATGG - Intergenic
1176639132 21:9281258-9281280 AACTCAGAGCTCCAAGGGAATGG + Intergenic
1177288516 21:19080632-19080654 CAAGAACAGCACCAAGGGAATGG + Intergenic
1180372439 22:12054101-12054123 AACTCAGAGCTCCAAGGGAATGG + Intergenic
1180415907 22:12712918-12712940 AACTCAGAGCTCCAAGGGAATGG + Intergenic
1180423178 22:12888765-12888787 AACTCAGAGCTCCAAGGGAATGG + Intergenic
1181490128 22:23256383-23256405 TTCCCACAGCACCCCGGGCAAGG - Intronic
1182665384 22:31955138-31955160 TACCCCCAGCTCCTAGTGAAAGG - Intronic
1183966402 22:41445448-41445470 TACCCACCGTACCCTGGGAATGG - Intronic
1184748848 22:46472775-46472797 GACCCCCAGCCCCCAGGGAAAGG - Intronic
1185336929 22:50274907-50274929 GACCCACAGAGCCCAGGGAAGGG + Intergenic
949589159 3:5475290-5475312 TACGCATGGCACAAAGGGAAGGG + Intergenic
949755076 3:7399798-7399820 TACTCACAGCAGGAAGGGACGGG - Intronic
949881487 3:8664362-8664384 TATACACAGCGCCAAGGGAAAGG - Intronic
952125328 3:30293016-30293038 TTCCCACAGCACAAAGGGCTGGG + Intergenic
952807825 3:37374393-37374415 TGACAACAGCACCAAGGGGATGG + Intergenic
952865314 3:37851417-37851439 TACTCACAGATCCAAGAGAAGGG + Intergenic
953747635 3:45587217-45587239 TATCCCCAGCACCTAGGAAAGGG + Intronic
954716940 3:52531652-52531674 CACCCACACCACCTATGGAAGGG - Intronic
954810567 3:53244743-53244765 CACACACAGCACCACGGGATGGG - Intronic
955251049 3:57282719-57282741 TAACCAAAACTCCAAGGGAAGGG - Intronic
955383510 3:58460366-58460388 TAGCAACAGAACCAAGGCAATGG + Intergenic
956064230 3:65379876-65379898 TCCCCATTGCACAAAGGGAAGGG + Intronic
956573169 3:70719657-70719679 TAATAAAAGCACCAAGGGAATGG + Intergenic
957101071 3:75829559-75829581 AACCCGGAGCTCCAAGGGAATGG - Intergenic
957683286 3:83467739-83467761 TACCCATATGACCAAGGGCATGG - Intergenic
959494401 3:107032674-107032696 AACCCAAAGAACCAAGGGAAAGG + Intergenic
961051171 3:123748251-123748273 TTCACACATCACCAAGGGGATGG + Intronic
961335802 3:126179195-126179217 TCCCCACACCACCAAGTGAAAGG - Intronic
964077100 3:152705499-152705521 TACTCACAGTTCCAAGAGAAGGG + Intergenic
965341915 3:167502067-167502089 CAAAAACAGCACCAAGGGAATGG - Intronic
967409417 3:189152407-189152429 AACCCCCAGCTCCAAGTGAAGGG + Intronic
1202747763 3_GL000221v1_random:123761-123783 AACTCAGAGCTCCAAGGGAATGG - Intergenic
969094164 4:4719593-4719615 TTCACTCATCACCAAGGGAATGG + Intergenic
969129311 4:4979913-4979935 TAAGAACAGCACCAAGGGGACGG + Intergenic
969353666 4:6612858-6612880 GGCCCACATAACCAAGGGAAGGG + Intronic
976741120 4:88358537-88358559 TCACAACAGCACCAGGGGAATGG - Intergenic
979478573 4:121187252-121187274 TACCCACAGAACTAATGCAAGGG - Intronic
982926176 4:161339550-161339572 CACCCTCATCACCAAGGGGATGG - Intergenic
983688462 4:170438511-170438533 TTCCCCCCACACCAAGGGAAGGG - Intergenic
1202754029 4_GL000008v2_random:39671-39693 AACTCAGAGCTCCAAGGGAATGG + Intergenic
986663927 5:10083499-10083521 CACCCACAGCACCAAATGGAAGG + Intergenic
987289408 5:16494463-16494485 TGAGCACAGCACCAAGGGGATGG - Intronic
989296479 5:39833203-39833225 TAAGGACAGCACCAAGGGTATGG + Intergenic
991499659 5:67264374-67264396 TTCCTACAGAAACAAGGGAATGG + Intergenic
992195021 5:74330553-74330575 CACCAACAGCCCCAAGGGAAGGG + Intergenic
993511698 5:88778790-88778812 TTCCCAAAGTACCAAGGAAAAGG + Intronic
994241575 5:97427732-97427754 TTCACACACCACCAAGGAAAAGG - Intergenic
997417683 5:133741531-133741553 CACCCATAGCAGCCAGGGAATGG + Intergenic
998003119 5:138640080-138640102 TTTCCACAGAACCAAGGGAGAGG + Intronic
998231499 5:140363953-140363975 TACCCATAGTCCCAGGGGAAGGG - Intronic
999202747 5:149827910-149827932 GAGCCACAGCACCAAGGGAGGGG - Intronic
1002102398 5:176863905-176863927 TCCACAAAGCACCAAGGGAGAGG - Intronic
1005483520 6:26277203-26277225 TCCCAACAGCTCCAAGGGAGTGG + Intergenic
1006451854 6:34109953-34109975 GACCTAGACCACCAAGGGAAGGG - Intronic
1008584268 6:52934809-52934831 TAAGGACAGAACCAAGGGAATGG - Intergenic
1010393336 6:75361347-75361369 CACCCTCACCACCAAGGGAGAGG - Intronic
1011161332 6:84393569-84393591 AACCCACAGCAGCCAGGGCATGG + Intergenic
1011941998 6:92854047-92854069 TATGCACAGCACAAAGGTAAGGG - Intergenic
1012734788 6:102925289-102925311 CAAGAACAGCACCAAGGGAATGG - Intergenic
1013482280 6:110563059-110563081 TACCAACAACACCAAGGACAGGG - Intergenic
1014619755 6:123652255-123652277 TGAACACAGCACCAAGGGGATGG - Intergenic
1014701928 6:124699546-124699568 CAAGAACAGCACCAAGGGAATGG - Intronic
1015045428 6:128770147-128770169 TAAGGACAGCACCAAGGGGATGG + Intergenic
1017023280 6:150159059-150159081 TACCCACAGGACGGAAGGAAAGG + Intronic
1018284836 6:162226339-162226361 TATCCACAGCACCCAGGAAGGGG - Intronic
1021102769 7:16602764-16602786 TGAGGACAGCACCAAGGGAAGGG - Intronic
1023830968 7:44038893-44038915 CATCCACAGGACCAAGGGCAAGG - Intergenic
1024217014 7:47256391-47256413 CACCCACAGCACCGAGGAGAGGG + Intergenic
1026503690 7:70964265-70964287 TACCCACAGTAGCAAGGACATGG + Intergenic
1026800237 7:73395847-73395869 TACCCTCAGCGCCCAGGGCATGG + Intergenic
1028159986 7:87475122-87475144 TCCCCCCTGCACAAAGGGAAGGG + Intronic
1028650765 7:93148626-93148648 TACCTACAGGACAAAGAGAATGG + Intergenic
1029741302 7:102493202-102493224 CATCCACAGGACCAAGGGCAAGG - Exonic
1029759292 7:102592371-102592393 CATCCACAGGACCAAGGGCAAGG - Exonic
1029776661 7:102688281-102688303 CATCCACAGGACCAAGGGCAAGG - Intergenic
1030086033 7:105816573-105816595 TCCCCACAGCCCTCAGGGAAGGG + Intronic
1032967408 7:137115670-137115692 AACCCACAGGATAAAGGGAATGG + Intergenic
1033284589 7:140029855-140029877 GGCCCACAGCAACAAGGAAATGG + Intronic
1033534871 7:142302918-142302940 TACCCCCAGCACCAAGGACTGGG + Intergenic
1033570137 7:142619348-142619370 TACCGACAGGACCCAGGGCAAGG + Intergenic
1033690610 7:143732964-143732986 TATCTACAGCCCCAAGGGCAGGG + Intergenic
1034358587 7:150474003-150474025 GTCCCACAGGCCCAAGGGAAAGG + Exonic
1035322480 7:158042191-158042213 TACCCACAGAAACCAGAGAATGG + Intronic
1035704419 8:1664265-1664287 TACCCATGCCACCACGGGAAGGG - Intronic
1036075102 8:5489911-5489933 CACCCACAGGCCCAAGGGAGAGG - Intergenic
1037683344 8:21117016-21117038 CAGCCACAGCATCAAGGGAGTGG - Intergenic
1038934405 8:32232560-32232582 TACCCAGACTACAAAGGGAAAGG + Intronic
1039859027 8:41440522-41440544 TACTCACTCCACCAAGGGAATGG + Intergenic
1041678713 8:60564288-60564310 TACCCACAGCACCAAGGGAAAGG - Intronic
1041907871 8:63053537-63053559 CAACAACAGCACCAAGGGGATGG + Intronic
1042445658 8:68882515-68882537 TACCTCCAGCACCAAGGGCAGGG + Intergenic
1043085672 8:75828123-75828145 TGAGAACAGCACCAAGGGAATGG - Intergenic
1046040431 8:108896924-108896946 TAAGGACACCACCAAGGGAATGG - Intergenic
1046373104 8:113337049-113337071 TACCCAAAGGACCAAGAAAATGG - Intronic
1048787257 8:138063431-138063453 CACACACAGCATCAAGGGAGGGG + Intergenic
1049944329 9:579770-579792 AACCCACAGCAACATGTGAACGG - Intronic
1050125035 9:2347942-2347964 TGAGGACAGCACCAAGGGAATGG - Intergenic
1050621934 9:7462886-7462908 TTCCCACAGCACCAACTGATAGG + Intergenic
1052665124 9:31486528-31486550 GACCCACAGGAACAAGAGAATGG - Intergenic
1053495469 9:38545481-38545503 TTCCAACAGGACAAAGGGAAAGG - Intronic
1053610618 9:39709740-39709762 TGAGAACAGCACCAAGGGAATGG + Intergenic
1053868653 9:42467762-42467784 TGAGAACAGCACCAAGGGAATGG + Intergenic
1054087635 9:60761417-60761439 TGAGAACAGCACCAAGGGAATGG - Intergenic
1054242905 9:62632655-62632677 TGAGAACAGCACCAAGGGAATGG - Intergenic
1054557029 9:66667173-66667195 TGAGAACAGCACCAAGGGAATGG - Intergenic
1055879852 9:80987672-80987694 CAAGGACAGCACCAAGGGAATGG - Intergenic
1057900185 9:98942672-98942694 TACCCACAACAGCCATGGAAAGG - Intergenic
1057918607 9:99077020-99077042 TAACCACAGCAGCAAAGGCAGGG + Intergenic
1059612800 9:115917230-115917252 TGAGAACAGCACCAAGGGAATGG + Intergenic
1060195167 9:121618835-121618857 CACCCCCACCACCAAGGCAAAGG - Intronic
1061744234 9:132727974-132727996 TACTCACAGCTCCCAGGAAAAGG - Intronic
1061857133 9:133448558-133448580 GACCCAGAGCCCCAAGGGACAGG - Intronic
1203757015 Un_GL000218v1:141167-141189 AACTCAGAGCTCCAAGGGAATGG - Intergenic
1203716398 Un_KI270742v1:153842-153864 AACTCAGAGCTCCAAGGGAATGG - Intergenic
1203534817 Un_KI270743v1:24397-24419 AACTCAGAGCTCCAAGGGAATGG + Intergenic
1203650626 Un_KI270751v1:117397-117419 AACTCAGAGCTCCAAGGGAATGG - Intergenic
1185516377 X:701990-702012 TATCCACAGCAGCAATGGACTGG - Intergenic
1185821791 X:3212198-3212220 CACAAACAGCACCAAGGGGATGG - Intergenic
1187232441 X:17435542-17435564 TCCCCAAATCACCAAGGGCAGGG - Intronic
1187556625 X:20358099-20358121 TATTCACAGCAGCCAGGGAATGG - Intergenic
1187882665 X:23861239-23861261 CAAGGACAGCACCAAGGGAATGG - Intronic
1189370381 X:40423318-40423340 GAACAACAGCACCAAGGGCATGG - Intergenic
1190968604 X:55327428-55327450 TAGCCAAAGAACCAGGGGAAGGG - Intergenic
1192118376 X:68432786-68432808 TTTCCACACCACCAGGGGAAGGG - Intronic
1193600392 X:83503393-83503415 GACCCTCACTACCAAGGGAAAGG - Intergenic
1194418894 X:93648603-93648625 TAAGAACAGCACCAAGGAAATGG - Intergenic
1195369587 X:104159702-104159724 TACCCACAGCAGCTGGGGGATGG - Intergenic
1198237444 X:134748505-134748527 TCCCCACATCACCAATGGTAAGG + Intronic
1198309614 X:135417712-135417734 TGACAACAGCACCAAGGGGATGG - Intergenic
1199098856 X:143774487-143774509 CAAAGACAGCACCAAGGGAATGG + Intergenic
1201170594 Y:11258791-11258813 AACTCAGAGCTCCAAGGGAATGG - Intergenic