ID: 1041684970

View in Genome Browser
Species Human (GRCh38)
Location 8:60635414-60635436
Sequence TTAGCTATATAATGCCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041684970 Original CRISPR TTAGCTATATAATGCCATCC AGG Intergenic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
906710082 1:47922930-47922952 TGAGCTTTATAAGGCCATTCAGG - Intronic
907555482 1:55340007-55340029 TTCCCTTTCTAATGCCATCCGGG + Intergenic
912051381 1:105532791-105532813 TTAGTTTTACAATGCCATCCAGG + Intergenic
918738787 1:188101073-188101095 TTAGAAATATCATGCCATCTTGG - Intergenic
919203511 1:194390589-194390611 TTAGGTAAATAATGCAATTCAGG + Intergenic
921161420 1:212474901-212474923 TTAGCCATAAAATGACTTCCAGG + Intergenic
1069082382 10:64102150-64102172 GTATCTATATACTGACATCCAGG - Intergenic
1071285691 10:84142253-84142275 TTAGCTATATTTTGTCATCTGGG - Intronic
1078730354 11:13968295-13968317 TTTGCTCCATAAGGCCATCCAGG + Intronic
1081437154 11:43039820-43039842 TTAGCTTTAAAATGTCTTCCTGG + Intergenic
1088296523 11:108302476-108302498 TTAGAATTATAATGCCTTCCAGG - Intronic
1098966276 12:76792388-76792410 TTGGTTATATAATCCCATCAAGG + Intronic
1107894435 13:44946911-44946933 TCAGCTTTATTAAGCCATCCAGG - Intronic
1108603358 13:52013293-52013315 TTAGGTATATACTGCTATTCAGG - Intronic
1110797785 13:79659923-79659945 TTGTCTATTAAATGCCATCCTGG - Intergenic
1111607083 13:90553597-90553619 TGAGCTATAGAATGCTATCAAGG - Intergenic
1114033369 14:18596165-18596187 TTAGCTAATTAATGGCTTCCTGG + Intergenic
1114078163 14:19175365-19175387 TTAGCTAATTAATGGCTTCCTGG + Intergenic
1114125331 14:19719188-19719210 TTAGCTAATTAATGGCTTCCTGG - Intronic
1114333508 14:21662593-21662615 TAAAATATATAATGCCAGCCAGG - Intergenic
1116006701 14:39299784-39299806 GTAGCTACATAATGCCTTCTTGG + Intronic
1124927694 15:34087661-34087683 TTAGCTACATAAAGAGATCCAGG + Intronic
1125138137 15:36368281-36368303 TTTTCTATATCATGCCATTCTGG - Intergenic
1126057831 15:44748478-44748500 AATGCTATATAATGCCTTCCAGG - Intronic
1131969862 15:97881088-97881110 TTTGATATATAATGCTAACCTGG - Intergenic
1138943633 16:61820931-61820953 TTAGCCTTATAATGCCATCCTGG + Exonic
1139514346 16:67444543-67444565 TGAGCTCTACAATGCCATTCTGG - Exonic
1143693290 17:8589357-8589379 TTAGGCATATAAAGTCATCCAGG - Intronic
1144470557 17:15536483-15536505 TTAGCTAGGGAATGGCATCCTGG - Intronic
1144925785 17:18807189-18807211 TTAGCTAGGGAATGGCATCCTGG + Intergenic
1147234200 17:39045206-39045228 TTAACTAGACAAAGCCATCCTGG - Intergenic
1148084800 17:44987599-44987621 TTAGGGATATAATGAGATCCTGG - Intergenic
1156381389 18:36564634-36564656 TTAGCTACATAATGTCCTGCTGG + Intronic
1157772793 18:50364456-50364478 TTAGCTATCTTATTCCATTCAGG + Intergenic
1159088720 18:63822598-63822620 TTAGCTACCAAGTGCCATCCTGG + Intergenic
1159270878 18:66148631-66148653 ATACATATATAATGACATCCAGG + Intergenic
1159289810 18:66402095-66402117 TTACATCTGTAATGCCATCCAGG + Intergenic
1166277380 19:41763359-41763381 TTTGCTATTTAAGGACATCCTGG - Intronic
930720321 2:54631705-54631727 TTATCCATATAATTCCATACAGG - Intronic
933085516 2:78049949-78049971 TAACCTATGTAATACCATCCTGG - Intergenic
933862615 2:86485008-86485030 TTAGAGATATGATGCCTTCCAGG + Exonic
940433791 2:153626826-153626848 TTGGCTATACAATGCCAGCCAGG - Intergenic
943475807 2:188353859-188353881 TTAGTTACATAATGCCTCCCAGG + Intronic
943771055 2:191717585-191717607 TCAGCTATAAAATGCTACCCTGG - Intergenic
943813565 2:192222089-192222111 TTATATATATATTGCCATCAAGG - Intergenic
946694537 2:222340882-222340904 TTAGATAAATAATGACATGCCGG - Intergenic
1178385099 21:32142674-32142696 TTAGCTTTATCTTGCCTTCCTGG + Intergenic
1180457484 22:15523220-15523242 TTAGCTAATTAATGGCTTCCTGG + Intergenic
1183496931 22:38151720-38151742 TTAGCTATGTATTCCCTTCCAGG - Intronic
950613515 3:14140955-14140977 TCAGCTATGGAATGCCAACCTGG + Intronic
951273258 3:20653804-20653826 GTGGCTATATAATGTCATCAAGG + Intergenic
962452784 3:135534759-135534781 ATAGCTCCAAAATGCCATCCAGG + Intergenic
963131261 3:141860343-141860365 TTAGTTATATGATGCCCTTCAGG - Intergenic
963172829 3:142268159-142268181 TTAGCTATAGAATTATATCCAGG + Intergenic
963524691 3:146403349-146403371 TTTGCTTTATAAAGCCCTCCAGG - Intronic
963809705 3:149763846-149763868 TTAACTGCATAATGCCATCTTGG + Intronic
974285685 4:59864481-59864503 TTATCTAGAAAATGCCATCCAGG + Intergenic
974777704 4:66508085-66508107 TTAGTTTCATAAAGCCATCCAGG - Intergenic
976885633 4:89980270-89980292 TTTAATATATAATGGCATCCAGG - Intergenic
976997832 4:91457969-91457991 TTAACTATATAATGCAATAATGG + Intronic
981095781 4:140778972-140778994 TTAGCTATATTTAGCCCTCCAGG - Intergenic
981581768 4:146256627-146256649 TTGGTTATATGATGCCATCTGGG - Intronic
982695544 4:158595414-158595436 TTTCCTATATAGTGCCTTCCTGG + Intronic
982796645 4:159654214-159654236 ATAGGTATATAGTGCCATGCAGG + Intergenic
983553399 4:169038632-169038654 TTAATTATAAACTGCCATCCTGG + Intergenic
985142144 4:186851929-186851951 TTGGCTCTATTGTGCCATCCAGG - Intergenic
987235078 5:15934921-15934943 ATAAATATATAATGCCACCCAGG + Intronic
987896695 5:23955383-23955405 TTATTTATCTAAAGCCATCCAGG + Intronic
991696048 5:69273449-69273471 TTTCCTATATAATGCAATCCAGG + Intronic
997389206 5:133499812-133499834 TTAGCTTTATTATGAGATCCTGG + Intronic
998667530 5:144315693-144315715 TTATTTATGTAATGCCATGCAGG + Intronic
1002274158 5:178093479-178093501 TTAGAAATACTATGCCATCCTGG - Intergenic
1003845285 6:10167338-10167360 TCAGCTATGTATTGCCATCATGG - Intronic
1007270022 6:40629326-40629348 TTAGGTATAGAATGCCTTCCTGG + Intergenic
1010445971 6:75948991-75949013 TTAGCTCTATGATGCCATTCAGG - Intronic
1011844894 6:91551608-91551630 CAAACTATATAATTCCATCCCGG + Intergenic
1013300209 6:108798191-108798213 TTAGCTATTTAAATCCAACCAGG + Intergenic
1013370992 6:109470949-109470971 TTACCTATCTAATCCCCTCCTGG + Intronic
1014199728 6:118595166-118595188 GTAGCTATTTAATGGCCTCCAGG + Intronic
1014869712 6:126578550-126578572 TTTGCTATAGAATGGCAACCAGG + Intergenic
1017457888 6:154619087-154619109 TTACCTTTATAATGGAATCCTGG - Intergenic
1017520971 6:155202273-155202295 TTAGCTGTACTGTGCCATCCAGG - Intronic
1018809343 6:167286518-167286540 CAAGCGAGATAATGCCATCCTGG - Intronic
1020333251 7:7041439-7041461 CTAGCTATATAATCCCAACTTGG - Intergenic
1022176728 7:27878074-27878096 ATAGCTATATAATTCCCTCTGGG - Intronic
1024684725 7:51732845-51732867 TTGTCTATATGATGCCATGCAGG + Intergenic
1031416780 7:121504768-121504790 TTAGCTAAAGAATGCAGTCCAGG + Intergenic
1032243253 7:130183386-130183408 TTATCCATAAAATGCCATCCAGG + Intronic
1033655530 7:143371274-143371296 TTAAATATATCATTCCATCCTGG - Intergenic
1038143290 8:24869698-24869720 TTTGTTATTTAATGCCATACTGG - Intergenic
1041684970 8:60635414-60635436 TTAGCTATATAATGCCATCCAGG + Intergenic
1042589372 8:70381849-70381871 TTACCTATAAAATGCCATTACGG - Intronic
1044368774 8:91383363-91383385 TAAGCTAAATAAAGTCATCCAGG + Intronic
1051504854 9:17815795-17815817 TGAACTAGATTATGCCATCCTGG - Intergenic
1052099232 9:24423766-24423788 TTACCTATATTATGCCATTTGGG + Intergenic
1056058979 9:82862697-82862719 TTAGCTCTTGAATACCATCCAGG - Intergenic
1058287759 9:103201889-103201911 TCAGCAAGATAATGGCATCCTGG - Intergenic
1058493638 9:105530012-105530034 TTAGCTATATAGTGCTCTCTAGG + Intronic
1061096184 9:128457773-128457795 TTAGCAAGATAATGGAATCCAGG + Intronic
1185628809 X:1501414-1501436 TGAGCTATATAATGTCACCATGG - Intronic
1192929337 X:75788849-75788871 ATAGCCATACAATGTCATCCAGG - Intergenic
1199700432 X:150371484-150371506 TGAGCTAGTTAATGGCATCCAGG + Intronic