ID: 1041689892

View in Genome Browser
Species Human (GRCh38)
Location 8:60678672-60678694
Sequence GCCCGGAGGGAGCTGGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 387}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041689877_1041689892 24 Left 1041689877 8:60678625-60678647 CCTGACGTCAGGTGGCGGCGCGC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1041689892 8:60678672-60678694 GCCCGGAGGGAGCTGGCGGCGGG 0: 1
1: 0
2: 4
3: 38
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041689892 Original CRISPR GCCCGGAGGGAGCTGGCGGC GGG Intergenic
900113895 1:1020580-1020602 GCGAGGAGGGAGGCGGCGGCGGG - Intronic
900237493 1:1599774-1599796 GCGCGCAGGGAGCGGCCGGCCGG + Exonic
900409983 1:2508078-2508100 GGCTGGGGGGAGCTGGCAGCAGG - Intergenic
900473033 1:2863858-2863880 GCCCGGAGGGAGTTGGGGGTGGG - Intergenic
900482938 1:2908141-2908163 GCGGGGAGGGAGCTGGGGGCAGG - Intergenic
900786770 1:4654657-4654679 GCGCGGTGGGCGCGGGCGGCGGG + Intergenic
901045255 1:6392490-6392512 CCCCAGAGGAAGCTGGAGGCTGG - Intronic
901641299 1:10694451-10694473 GGCAGGAGGGAGCGGGCGGGCGG + Intronic
902671829 1:17979983-17980005 CCCCAGAGGGAGCTGGAAGCAGG + Intergenic
902817004 1:18922255-18922277 CCCTGGAGGAAGCTGGGGGCAGG + Intronic
902870707 1:19312178-19312200 GCGCGGAGGCAGTTGGGGGCGGG + Intergenic
903189544 1:21649090-21649112 GCCCGGAGGCACCTGCCTGCTGG + Intronic
903303147 1:22393172-22393194 GCCAGGAGCAAGCTGACGGCTGG + Intergenic
904528791 1:31154985-31155007 GACCGGAGGGAGCGGGGGGGAGG + Intergenic
904829748 1:33299103-33299125 CCCCGGAGGGAGCTGGGGCCTGG - Exonic
904857289 1:33509282-33509304 TCCCGGAGGGAGGTGGGGGGGGG - Intergenic
905011709 1:34751562-34751584 TCCAGGAGGGAGCTGGAGGTGGG - Intronic
905416702 1:37808710-37808732 GCCCGGAGCCGGCTGGTGGCGGG + Exonic
905524087 1:38623542-38623564 ACCCTGAGGGAGCTGTTGGCTGG - Intergenic
906246799 1:44281964-44281986 TCCTGGAGGGAGCTGGGAGCAGG + Intronic
906761834 1:48383352-48383374 TCCGGGAGGGAGGTGGCGGGGGG - Intronic
907524036 1:55043546-55043568 GCCCGTAGAGAGCTGGGTGCAGG + Intronic
908370228 1:63473330-63473352 TCCGGGAGGGAGGTGGCGGGGGG + Intronic
912682529 1:111738566-111738588 GCAGGGAGGGGGCTGGCAGCTGG - Intronic
915507182 1:156365340-156365362 GACTGGAGGGAGGTGGCAGCAGG - Intronic
915539213 1:156557147-156557169 TCCGGGAGGGAGGTGGCGGGGGG + Intronic
915572495 1:156751967-156751989 GCCCGGGAGGAGCTGGCGCCCGG + Intronic
915902241 1:159855275-159855297 GCCTGGAGGGGGCTGCCTGCAGG - Exonic
915938171 1:160101005-160101027 GCTGGGAAGGAGCTGGGGGCAGG + Intergenic
916246854 1:162696816-162696838 GCCCAGGGGAAGCTGGTGGCTGG - Intronic
917788724 1:178486450-178486472 GCCCAGAGGCAGCTGGGAGCTGG - Intergenic
917974610 1:180230694-180230716 GGCCGGGAGGGGCTGGCGGCCGG + Intronic
919772421 1:201171117-201171139 GGACGGAGCGAGCGGGCGGCTGG - Intronic
920178354 1:204117247-204117269 GCCTGGAGGGTGCTGGGGACAGG + Intronic
920652066 1:207845256-207845278 TCCTGGAGGGAGCTGTCGCCCGG - Intergenic
922496538 1:226062330-226062352 GCCCGGAGGGAAGTGGGGGGAGG - Intronic
922573707 1:226648192-226648214 GCCCTGAGGGAGCCTGCAGCTGG - Intronic
922593961 1:226799360-226799382 GCCCTGTGGGAGCTGGCAGGAGG + Intergenic
1062855011 10:775710-775732 GCCCGCAGGAAGCTGGGGGCCGG + Intergenic
1063261260 10:4392029-4392051 GCCCAGAGTGAGCTGAGGGCTGG + Intergenic
1063504009 10:6580163-6580185 GCCGGGAGGGAGCGGGCTGGAGG - Intronic
1064354229 10:14603801-14603823 GCCTGGCGGGGGCTGGCGTCGGG + Intronic
1065342901 10:24723414-24723436 GGCCGGAGGGAGCCCGCGGCGGG - Intronic
1065925915 10:30433919-30433941 GCCCGGGCGGAGCTGGAGGCGGG - Exonic
1065956088 10:30694668-30694690 GGCTGGAGGGAGCTGGCTGGGGG + Intergenic
1067060871 10:43077342-43077364 CCCCTGCGGGAGCCGGCGGCCGG - Intronic
1067088559 10:43255225-43255247 GCCTGGAGGGCGCTGGGGCCTGG - Intronic
1067937320 10:50623456-50623478 GCTCGGAGGGGGCGGGCCGCCGG - Intronic
1068955851 10:62818187-62818209 GCCCGGCGAGAGCTGGCGCACGG - Intronic
1069557779 10:69408865-69408887 GCCTGGAGGGGGCGGGGGGCTGG - Intronic
1069984378 10:72273640-72273662 TCCCCGAGGGCGCTCGCGGCAGG - Intergenic
1070668283 10:78360706-78360728 GCCAGGAGGGTGCAGGTGGCAGG - Intergenic
1071553485 10:86585177-86585199 ACCTGTAGGGAGCTGGGGGCTGG - Intergenic
1073190951 10:101650414-101650436 GCTCTGAGGGAGGTGGGGGCAGG - Intronic
1074182728 10:111077949-111077971 GCCGGAAGGCAGCTGGCAGCAGG + Exonic
1074503132 10:114044026-114044048 GCGCAGAGGGAGGTCGCGGCCGG - Intergenic
1075040699 10:119104565-119104587 GCCGGGCGGGAGCAGCCGGCTGG + Intronic
1075684281 10:124353227-124353249 GGCGGGAGGGAGCTGGGGTCGGG - Intergenic
1075741953 10:124701448-124701470 GACCAAAGGGAGCTGGTGGCTGG - Intronic
1076594788 10:131618879-131618901 GGCGGGAGGGCGCTGGCTGCAGG + Intergenic
1076639028 10:131901382-131901404 GCCCGGAGGCCGCGCGCGGCCGG - Intronic
1076841585 10:133048564-133048586 GCCCGGAGGGTGGAGGCAGCAGG + Intergenic
1077130595 11:970472-970494 GCCCGCAGGGTGTTGGCAGCAGG - Intronic
1077160481 11:1110299-1110321 GCCCGGCGGGAGGTGCCGGTGGG - Intergenic
1077208783 11:1358443-1358465 GCCGGGAGGGAGCAGCCGGGTGG - Intergenic
1077208796 11:1358490-1358512 GCCAGGAGGGAGCAGCCGGGTGG - Intergenic
1077364063 11:2154504-2154526 GGAAGGAGGGAGCAGGCGGCTGG - Intronic
1077369493 11:2174792-2174814 GCCTGGAGGGAGCACACGGCTGG + Intergenic
1078104299 11:8349079-8349101 GAACAGAGGGAGCTGGCGGTGGG - Intergenic
1078579240 11:12525886-12525908 GCCTGGAGGGAGCAGGCAGGAGG + Intronic
1080641045 11:34158529-34158551 GCCAGGAGGCAGCTGGCAGGTGG - Intronic
1081789376 11:45772058-45772080 GCCCGGAGGGAGCTGGGTTCCGG - Exonic
1082795773 11:57376810-57376832 GACGGGAGGGAGCTGCTGGCAGG + Exonic
1083155483 11:60820496-60820518 TCCTGGAGGGAGCTGGAGCCTGG - Intergenic
1083315929 11:61815170-61815192 GCCGGGGCGGAGCCGGCGGCCGG + Intronic
1084356466 11:68641913-68641935 ACCCTGGGGGAGCTGGCAGCTGG - Intergenic
1084435414 11:69136572-69136594 GCCTGGATGGCACTGGCGGCCGG + Intergenic
1084642474 11:70434109-70434131 GCCACACGGGAGCTGGCGGCCGG - Intronic
1085476137 11:76790035-76790057 GCCAGGAGGGAGTGGGGGGCGGG - Intronic
1089432591 11:118436379-118436401 GCCGGCAGGGTGCAGGCGGCCGG + Intergenic
1089848722 11:121479203-121479225 GCCCCCAGGGAGGTGGAGGCGGG + Intronic
1090411786 11:126514098-126514120 GCTGGGAGCGAGCTGGTGGCAGG + Intronic
1090549930 11:127808662-127808684 GCCAGGAGGCAGCTGGAGGTGGG - Intergenic
1090665708 11:128913875-128913897 GCCCCCAGGAAGCTGGCTGCCGG + Intronic
1090795628 11:130133558-130133580 GCCAGGAGGGAACTTGCAGCTGG - Intronic
1091549948 12:1529986-1530008 GCCCCGAGGGGGCTGCTGGCCGG + Intronic
1091558295 12:1592697-1592719 GCCGGGAGGGGGCTGGAGGAGGG + Intronic
1091744478 12:2982463-2982485 GCCAGGGGAGAGCTGGAGGCGGG - Intronic
1092106233 12:5923483-5923505 TCCCCGAGGGAGGTGGGGGCTGG - Intronic
1092160935 12:6315140-6315162 TCCTGGAGGGAGCTGGTGCCTGG + Exonic
1095440899 12:42238110-42238132 GCCCGGACTGTGCGGGCGGCAGG - Intronic
1096529304 12:52233265-52233287 GCCGGGATGGACCTAGCGGCGGG - Exonic
1097500154 12:60391991-60392013 GGCAGGAAGGAGCTGGGGGCAGG + Intergenic
1099973795 12:89525776-89525798 ACCTGGAGGGAGATGGAGGCAGG - Intronic
1101447604 12:104748530-104748552 GCCCGGTGGGGGCTGGAGGGGGG + Intronic
1101717169 12:107320844-107320866 GGCAGGATGGAGCTGGCGGGGGG + Intronic
1101909269 12:108850127-108850149 TCCAGGAGGGAGCTGGGGGAGGG + Intronic
1101909286 12:108850167-108850189 TCCAGGAGGGAGCTGGGGGAGGG + Intronic
1101909302 12:108850207-108850229 TCCAGGAGGGAGCTGGGGGAGGG + Intronic
1101909318 12:108850247-108850269 TCCAGGAGGGAGCTGGGGGAGGG + Intronic
1103595505 12:122022424-122022446 GCCCGGAGGCGGCGGGCGCCGGG + Intronic
1103749787 12:123150878-123150900 GCCCGGGGCCAGCAGGCGGCGGG - Intergenic
1103856406 12:123973391-123973413 TCCCGGAGGGAGGCGGGGGCCGG + Exonic
1104845038 12:131842378-131842400 GCCGGGAGGGTCCGGGCGGCAGG - Intronic
1104882796 12:132084198-132084220 ACCCGGAGGGACGTGGCGGAGGG - Intergenic
1104984686 12:132590010-132590032 GGCCGGAGGGTTCTGGGGGCAGG + Intergenic
1106735851 13:32586973-32586995 GGCGGGAGGGCGCGGGCGGCCGG - Intronic
1107885725 13:44872878-44872900 TCCCGGAGGGAGGTGGCCCCTGG - Intergenic
1109227574 13:59714794-59714816 GCCCTGAGGGAGCTGGCTGGGGG + Intronic
1111951852 13:94713771-94713793 GCCGGGAGGAAGAAGGCGGCGGG + Intergenic
1112051175 13:95644658-95644680 GGCCGGAGGGAGATCGCGGAGGG - Intronic
1113119036 13:106906620-106906642 GGCAGCAGGGAGCAGGCGGCGGG + Intergenic
1113263694 13:108593394-108593416 TCCCGGAGGGAGCTGCCGGCAGG + Intergenic
1113513643 13:110874586-110874608 GCACGGCTGGAGCTGGGGGCTGG - Intergenic
1113728333 13:112622421-112622443 GAACGGAGGGACCTGGCGACAGG - Intergenic
1113775724 13:112943800-112943822 GACCGGAAGGACCTGGCGGGAGG + Intronic
1114195050 14:20469609-20469631 GCCCAGAGGGAGCTGGCGGAGGG + Intronic
1115753560 14:36513633-36513655 GCCAGGAGGGGGGTGGGGGCAGG - Exonic
1116018419 14:39432869-39432891 GCTGAGAGGGAGCTGGCGGACGG + Intergenic
1118894075 14:69931310-69931332 GCCCGGAGGGAGCGGGACTCAGG - Intronic
1119140708 14:72264976-72264998 GCCAGGAGGGAGTTGGAGGAGGG + Intronic
1119327833 14:73772053-73772075 GCCCTGAGCCAGCTGGGGGCTGG + Intronic
1121012413 14:90528243-90528265 GCCTGGAGGAAGCTGGAGTCTGG + Exonic
1122786725 14:104167393-104167415 GCCCTGAGGGGGCTGGGGGCAGG + Intronic
1122939569 14:104975196-104975218 GCCGGGAGGGAGCGGGCTCCTGG + Intronic
1123019790 14:105392289-105392311 GCCTGGAAGGAGCCGGCGGCTGG - Intronic
1124009817 15:25829696-25829718 GCCAGGAGAGAGCTGGGGGAAGG + Intronic
1124453773 15:29822247-29822269 GCTCGGAGGGAGGTGCCGGTCGG - Exonic
1125520281 15:40344584-40344606 GCCCTGAGGGAGCCGGTGGGTGG + Intergenic
1129659402 15:77544608-77544630 GGCAGGAGGGAGCTGGAGGTGGG - Intergenic
1131119781 15:89814936-89814958 GCCCGGGCGGAGCTGCGGGCGGG - Intronic
1131176568 15:90212952-90212974 GCCCGGTGAGAGCTGGCAGAAGG - Intronic
1131831093 15:96354788-96354810 GCTTGGAGGGAGGTGGGGGCCGG - Intergenic
1132178265 15:99732881-99732903 GCCCGGAGGCGGGAGGCGGCCGG + Intronic
1132512785 16:352562-352584 GGCGGGTGGGAGCTGGCGGCTGG - Exonic
1132697925 16:1210187-1210209 CCCAGGAGGGACCTGGGGGCGGG - Intronic
1132900449 16:2251381-2251403 GGGCGGACGGAGCGGGCGGCCGG - Exonic
1132925375 16:2426539-2426561 GCCCGTAGGCCGCTGGGGGCTGG + Intergenic
1132934588 16:2474229-2474251 GTACCGAGGGAGCTGCCGGCGGG - Intergenic
1133103376 16:3492506-3492528 GCCCAGAGGGACCTGGGAGCTGG + Intergenic
1133269071 16:4601862-4601884 GCCAGGAGGGAGCTGGAGGGGGG + Intergenic
1135023854 16:18984182-18984204 GCACGGAGGGAGCCGGGTGCTGG + Intronic
1135407185 16:22206743-22206765 GCCCGGGTGCAGCTGGCGTCTGG + Intronic
1136414785 16:30096360-30096382 GGCCGGCGGGAGCGGGCGGCGGG - Intronic
1137603986 16:49775061-49775083 GCCTGGAGGGAGCTGGGCGGAGG - Intronic
1138327934 16:56191204-56191226 GCCGGGAGGGCGCTGGGGGGAGG + Intergenic
1139701388 16:68710139-68710161 GCAGGGAGGGAGCAGGCGGAGGG - Intronic
1139851438 16:69953170-69953192 GCCCGGAGGGTGCTCGGGGCCGG - Intronic
1139880415 16:70176082-70176104 GCCCGGAGGGTGCTCGGGGCCGG - Intronic
1140372095 16:74419435-74419457 GCCCGGAGGGTGCTCGGGGCCGG + Intronic
1141445213 16:84053498-84053520 GCCCCTAGGCTGCTGGCGGCCGG - Intergenic
1141928575 16:87185462-87185484 GCCCGGGGAGAGCAGGCAGCTGG - Intronic
1141961481 16:87412109-87412131 GCCGGGCTGGAGCTGGGGGCTGG + Exonic
1142116298 16:88357857-88357879 GGCCGGAGGGAGCCGGTGGCAGG + Intergenic
1142197415 16:88745206-88745228 GCCAGGAGGGAGTTGGAGTCGGG - Intronic
1142250328 16:88989045-88989067 GCCCGCTGGGAGCTGGCTGCTGG + Intergenic
1142395282 16:89828394-89828416 GCGCGGAGGGCGCGGGGGGCGGG - Intronic
1142967732 17:3591656-3591678 GGACGGAGGGAGGTGGAGGCAGG + Intronic
1143090978 17:4449007-4449029 GCCAGGAAGGATCTGGAGGCTGG + Intronic
1143769363 17:9158273-9158295 CCCAGGAGGAAGCTGGGGGCTGG - Intronic
1144185205 17:12790004-12790026 GCCTGGAGGGAGCTGGTGCAGGG - Intronic
1144671686 17:17136405-17136427 TCCCGCAGGGAGCTGGCAGCAGG - Exonic
1145278892 17:21454302-21454324 GCCCTGGGGGAGCTGGGGGAAGG + Intergenic
1145310779 17:21700100-21700122 GGAAGTAGGGAGCTGGCGGCAGG - Intronic
1145816241 17:27797067-27797089 GCCAGGAGTGGGCTGGGGGCTGG - Intronic
1146904239 17:36607965-36607987 TCCAGGAGGCAGCTGGCGCCGGG - Exonic
1147131683 17:38413362-38413384 GCCAGGAGGGAGGTGGCAGTGGG + Intergenic
1147150038 17:38509320-38509342 GCAGGGGCGGAGCTGGCGGCGGG + Intronic
1147168660 17:38605854-38605876 GCTGGGAGGGCGCCGGCGGCCGG + Exonic
1147591926 17:41689248-41689270 GACCGGAAGGAGCAGGCGGTAGG + Intronic
1147864860 17:43545614-43545636 GGCCGGAGGGAGCGGCCGGATGG - Exonic
1147994714 17:44354420-44354442 GCCCGGGGGGCGAGGGCGGCGGG - Exonic
1148698215 17:49573753-49573775 GCACTGAGGAAGCTGGGGGCAGG - Intergenic
1149595591 17:57862784-57862806 GCCCGGAGGGAGCTGAGGAAGGG + Exonic
1150168408 17:62966388-62966410 GCGCGGAGGGCGGTGGCGGCGGG - Intergenic
1150288765 17:63969462-63969484 GCCCCGAGGATGCTGGCAGCTGG + Intronic
1150313174 17:64146166-64146188 GCTGGGAGGGGGCTGGCGGGCGG + Intergenic
1150492303 17:65582920-65582942 GCCTGGAGGGAGATGGTGGTGGG - Intronic
1150610040 17:66726560-66726582 GACAGGTGGGAGCTTGCGGCAGG + Intronic
1151414578 17:73952916-73952938 GGCCGGAGGGAGCCGGCAGGGGG - Intergenic
1151519687 17:74619110-74619132 TCCAGGAGGAAGCTGGGGGCAGG - Intronic
1151836523 17:76585945-76585967 GCCGAGAGGGAGCTGCCGGGCGG - Exonic
1152089065 17:78237088-78237110 GGCCGGAGGTAGCTGGTGGATGG + Intronic
1152318419 17:79594442-79594464 GCCTGGAGGGGGCTGGCTGGTGG - Intergenic
1152528206 17:80901808-80901830 GCAGGGAGGGCGCTGGGGGCGGG - Intronic
1152571623 17:81123659-81123681 GCCCTGGGGGAGCTGGAGGGCGG + Intronic
1153457545 18:5296352-5296374 GGCGGGAGGGAGCTTGAGGCGGG - Intronic
1153699543 18:7678500-7678522 GCCCTGAGGGAACGGGAGGCCGG + Intronic
1154210803 18:12377240-12377262 GCCGGGGCGGGGCTGGCGGCAGG - Exonic
1156527196 18:37778278-37778300 GCCCTGAGGGAGCTCACTGCAGG - Intergenic
1160175730 18:76592555-76592577 GCCCAGAGGGGGCTGGGGGGTGG - Intergenic
1161280833 19:3444649-3444671 GCCTGCAGGGATGTGGCGGCCGG + Intronic
1161383956 19:3981162-3981184 TCCCGGATGGGGCTGGCTGCTGG + Intronic
1161586368 19:5107960-5107982 GACTGGAAGGAGGTGGCGGCTGG - Intronic
1161612570 19:5251290-5251312 TGGCGGAGGGAGCTGGCGGTGGG - Intronic
1161959544 19:7516188-7516210 GCCCGGGGGGAGCCGGCGGCCGG + Exonic
1162113338 19:8413301-8413323 GCCCGGACGCAGGTGCCGGCCGG + Intronic
1162433333 19:10642543-10642565 GCCCTGGGGAAGCTGGGGGCAGG - Intronic
1162683765 19:12365356-12365378 GCGGGGTGGGAGCTGGGGGCTGG - Intronic
1162744608 19:12791518-12791540 GCCAGCAGGGAGCTGGGAGCTGG + Exonic
1162907229 19:13831160-13831182 GCCCGGCTGGAGATGGGGGCAGG + Exonic
1162911590 19:13850656-13850678 GTCCGGAGGGGCCCGGCGGCGGG + Intergenic
1162954256 19:14089795-14089817 GACGGGCGGGCGCTGGCGGCCGG + Exonic
1163530866 19:17848077-17848099 GCCCTGCGGGAGCTGGGGGCGGG + Intergenic
1163668346 19:18613405-18613427 GGCCTGAGGGAGCTGGGGGTTGG - Intronic
1164693629 19:30227864-30227886 GCGCGGAGGGGGCCGGCGGAGGG + Intergenic
1165157045 19:33795478-33795500 GCCCGGCCGGAGCCGGCGGTCGG + Intergenic
1165242971 19:34482029-34482051 GCCCTGCGGGAGCTGGAGCCCGG + Exonic
1165429974 19:35766976-35766998 GCCTGGGGGGAGCTGGAGGAGGG + Intronic
1165446063 19:35857251-35857273 GCGAGAAGGGAGCTGGGGGCTGG + Intronic
1167147797 19:47693636-47693658 GGCTGGTGGGGGCTGGCGGCTGG + Intronic
1167679684 19:50911540-50911562 GCCCAGAAGGGGCTGGCAGCAGG + Intergenic
1167709953 19:51104417-51104439 GCCGGGCGGCAGCAGGCGGCCGG + Exonic
1167897460 19:52593427-52593449 TCCCGGAGGGAGCGGCTGGCCGG + Intergenic
1168105020 19:54161214-54161236 GCCCGGAAGGTGCGGGCAGCCGG + Exonic
1168297323 19:55383790-55383812 ACGCGGCGGGAGCCGGCGGCGGG + Exonic
1168316730 19:55487886-55487908 TCCCAGAGGGAGCTGGGGTCGGG - Intergenic
1168324074 19:55529465-55529487 GCCCTGGGGAAGGTGGCGGCAGG + Intergenic
925164722 2:1709028-1709050 CGCGGGAGGGAGCTGGTGGCCGG + Intronic
925656973 2:6159524-6159546 GCCCAGAGGGAGATGGGGGTAGG - Intergenic
925730672 2:6917762-6917784 GCCCGGTGGCAGCGGGCGGGGGG + Intronic
926626640 2:15095992-15096014 TCCCGAAGGGAGCTTGCGCCTGG - Intergenic
927554681 2:24023407-24023429 GCCGGCAGGGGGCTGGCGGGGGG + Intronic
927943271 2:27118922-27118944 GCCCGGGGGAGGCTGGCGGCGGG - Exonic
930379286 2:50607192-50607214 GTCTGAAGTGAGCTGGCGGCAGG - Intronic
930651751 2:53970829-53970851 GCCCGGAGAGGGGTGGGGGCCGG - Exonic
930727898 2:54699166-54699188 TCCCGGACGGAGCGGCCGGCCGG - Intergenic
933433589 2:82215494-82215516 GCCATGAAGGAGCAGGCGGCTGG - Intergenic
934553204 2:95274640-95274662 GCCCTGAGTCAGCTGGCTGCAGG + Exonic
934730114 2:96650982-96651004 GACAGGAGAGAGCTGGAGGCTGG - Intergenic
934754612 2:96816516-96816538 CCCCGGAGGGGGCGGGCTGCCGG + Exonic
935653132 2:105399002-105399024 GGCTGGAGGGCGCGGGCGGCTGG + Intronic
936329061 2:111531681-111531703 GCCTGGAGGCAGCAGGAGGCTGG - Intergenic
936904815 2:117525022-117525044 GCACTGAGGGAGCTGGGGGAGGG + Intergenic
936987726 2:118327470-118327492 GCATGGAGTGATCTGGCGGCTGG + Intergenic
937221455 2:120345121-120345143 GCCGGGAGAGAGCGGGCGGGCGG - Intergenic
937917743 2:127107197-127107219 GTCCGGAGGGGGCGGGCGGGGGG - Exonic
938465023 2:131519709-131519731 GGCAGGAGGGAGCTGGGGACGGG - Intergenic
938670119 2:133578460-133578482 AGCCTGAGGGAGCTGGCAGCTGG - Intergenic
940748536 2:157597510-157597532 GCCCCGCGGGAGCTGTCGTCGGG - Intronic
941603020 2:167563675-167563697 CCCCGGAGGGAGCGGCTGGCCGG + Intergenic
941603069 2:167563798-167563820 CCCCGGAGGGAGCGGCTGGCCGG + Intergenic
942240896 2:173964043-173964065 GCCAGGCGTGGGCTGGCGGCGGG - Intronic
944154188 2:196593416-196593438 GGCGGGAGGAAGGTGGCGGCAGG - Intronic
944217929 2:197274415-197274437 ACCCTGAAGGAGCTGGCAGCTGG - Intronic
945225854 2:207530412-207530434 GCGGGGTGGGAGCCGGCGGCCGG + Intronic
946068939 2:217014654-217014676 GCCATGAGGGAGGTGGGGGCAGG + Intergenic
946362850 2:219229444-219229466 GCCCTAAGTGAGCTCGCGGCGGG - Intronic
947122936 2:226836157-226836179 GGGCTGCGGGAGCTGGCGGCCGG + Intronic
947674023 2:231961460-231961482 GCCCGGAGCCAGCCGGCGCCTGG + Intronic
947765242 2:232633640-232633662 GGACGCAGGGAGCTGGCGGGCGG - Exonic
948382747 2:237562136-237562158 GCCCAGGGGTAGCTGGAGGCGGG - Intergenic
948467456 2:238159125-238159147 GCCCGCAGGGAGCCGCCGCCCGG + Exonic
948944928 2:241214695-241214717 GTCAGGAGGGAGGTGGGGGCCGG + Intronic
949065673 2:241989129-241989151 GACCAGATGGGGCTGGCGGCAGG + Intergenic
1169046568 20:2538109-2538131 GCCAGTAGGGAGCTGGCCCCAGG + Intronic
1169557609 20:6767627-6767649 GCCGGGAGGGAGCCGGCAGGCGG + Intergenic
1170280138 20:14637091-14637113 GACTGGAGGGAGCTGGTGGGAGG + Intronic
1170894103 20:20398687-20398709 GCCAGGAGGGACCTGACGTCTGG + Intronic
1170924789 20:20712718-20712740 GCCCCGCGGGAGGTGCCGGCCGG + Intergenic
1171086924 20:22246133-22246155 GACCTGAGGGAGGTGGAGGCAGG - Intergenic
1171386385 20:24771974-24771996 GCCGGAATGGAGCTGGAGGCTGG + Intergenic
1172091272 20:32434649-32434671 GCCCGGGTGGAGGTGGCGGCGGG + Exonic
1172457933 20:35092555-35092577 ACCAGGCGGGAGCTGGCGGGGGG - Intronic
1172613666 20:36269197-36269219 GCCTGCAGGGAGCTGGTGGGGGG + Intronic
1174958362 20:55126936-55126958 CCCAGGAGGGAGCTGGAGGAAGG - Intergenic
1175562208 20:59939983-59940005 GCACGGAGGGAGCTGTCGCGGGG - Exonic
1175735927 20:61386887-61386909 GCCCGGGGGGAGGAGGCGTCAGG + Intronic
1175899307 20:62353773-62353795 GCCCGGTGTGAGGTGGGGGCAGG - Intronic
1175990502 20:62786155-62786177 GCCTGGAGGGGCTTGGCGGCTGG - Intergenic
1176107401 20:63395871-63395893 GCCATGAGGGAGGAGGCGGCCGG + Intergenic
1176198300 20:63847986-63848008 GAGAGGAGGGAGCTGGGGGCTGG + Intergenic
1176380995 21:6111875-6111897 GTCCGGGTGGAGCGGGCGGCGGG + Intronic
1178599816 21:33985845-33985867 TCCCAGATGGAGGTGGCGGCAGG + Intergenic
1179415990 21:41199251-41199273 GCCGGGGAGGAGCTGGCTGCCGG + Intronic
1179742477 21:43426365-43426387 GTCCGGGTGGAGCGGGCGGCGGG - Intronic
1181052162 22:20243096-20243118 GCCCACAGGGAGCCGGCTGCTGG - Exonic
1181937451 22:26449069-26449091 GCCCTGAAGGAGCTGGCGGACGG - Intronic
1182226147 22:28800363-28800385 GCCCGGAGGCAGCGAGCGGGGGG - Exonic
1182355262 22:29719945-29719967 GCGCGGAGGGGGCGGGCGGGCGG + Intergenic
1182549691 22:31094092-31094114 GGCGGCAGGGAGCTGGGGGCTGG - Intronic
1183521567 22:38298701-38298723 GGCCAGAGTGAGCTGGTGGCGGG - Intronic
1183721782 22:39567037-39567059 GCCCTGAGGGGACTGGCAGCTGG - Intergenic
1184101587 22:42343973-42343995 GCCCGGATGGAGGCGGCGGGCGG + Intergenic
1184697961 22:46150375-46150397 GCCCGGAGGGCGCGCGGGGCGGG + Intergenic
1185233195 22:49694922-49694944 GGCTGGAGGGAGCTGGCAGCTGG - Intergenic
1185324524 22:50219212-50219234 GGCAGGAGGGAGCTGGAGTCAGG + Intronic
1185337069 22:50275473-50275495 GGCCGGAGGGAGCTGGGGCTGGG + Exonic
950099084 3:10346252-10346274 GCCTGGATGGAGGGGGCGGCTGG - Intronic
950195736 3:11007937-11007959 TCCTGGAGGGAGGTGGCTGCTGG + Intronic
950253713 3:11487743-11487765 TCCGGGAGGGAGCTGGGGGGGGG - Intronic
950260196 3:11537855-11537877 GCCCACAGAGAGCTGGTGGCTGG + Intronic
952293538 3:32041100-32041122 GCACGGAGGAAGCTGGCTCCGGG - Intronic
952788085 3:37176015-37176037 GCCCGGTGGGAGCAGGGAGCGGG - Intronic
953494229 3:43372505-43372527 GGGTGGAGGGAGCTGGTGGCTGG - Intronic
953627110 3:44580323-44580345 TCCCGCAGGGAGCTGGCAGCAGG + Intronic
954356180 3:50084829-50084851 TCCCGGAGGGAGCGGCTGGCCGG + Intronic
954363276 3:50133610-50133632 GCCAGGAGGCAGGTGGGGGCAGG - Intergenic
954882582 3:53846005-53846027 GCCCGGAGAGGCCTGGGGGCCGG - Intronic
955354316 3:58217757-58217779 ACCAGCAGGGAGCTGGCTGCTGG + Intergenic
961081701 3:124033507-124033529 ACCATGGGGGAGCTGGCGGCAGG + Intergenic
961175021 3:124827991-124828013 CAGCGAAGGGAGCTGGCGGCGGG - Intronic
961827512 3:129606704-129606726 GCCCGGAGGCGGCGGGAGGCGGG + Exonic
961827607 3:129606938-129606960 TCCTGGAGGGCGCGGGCGGCGGG - Intergenic
962314208 3:134348883-134348905 GCCCTGAAGGAGCAGGCAGCAGG - Intergenic
963239656 3:142990723-142990745 TCCCGGAGGGACCTGGTGGGAGG + Intronic
964092063 3:152889026-152889048 GCAGGGAGGGGGCTGGAGGCGGG + Intergenic
964400307 3:156291308-156291330 GGCGGGAGGGAGCTGACAGCCGG + Intronic
964509780 3:157437893-157437915 GCCCGGAGCTGGCTGCCGGCAGG + Exonic
965551242 3:169966981-169967003 GCCGCGAGGCAGCTGGCTGCAGG + Intronic
967883132 3:194315555-194315577 GCCTGGAGGGGGCGGGCAGCAGG + Intergenic
967968731 3:194984152-194984174 GCCCTGATGCAGCTGGAGGCTGG + Intergenic
968176261 3:196551881-196551903 GCCTGAAGGGAACTGGTGGCAGG - Intergenic
968724860 4:2242082-2242104 GCACGGAGGGCGGTGGCGGCGGG - Exonic
968923494 4:3534832-3534854 GCATGGCGGGTGCTGGCGGCAGG - Intergenic
969720950 4:8892871-8892893 GCGGGGAGGGGGCAGGCGGCCGG - Intergenic
975747169 4:77485971-77485993 ACCCTGAGGGAGCTGACAGCTGG + Intergenic
976595387 4:86890910-86890932 GGCCTTAGGGAGCTGGGGGCAGG + Intronic
978912647 4:114082661-114082683 GCACTGAGGGAGGTGGCGGAGGG - Intergenic
980043495 4:127964940-127964962 GCGCGGTGGGAGCCGGTGGCTGG - Intronic
983090292 4:163494518-163494540 GGCGGAAGGGAGCTTGCGGCGGG - Exonic
983527567 4:168774807-168774829 ACCAGGAGGGAGCAGGTGGCAGG - Intronic
985563463 5:603572-603594 GGACAGAGGGAGCTGGCTGCTGG - Intergenic
985620432 5:952171-952193 GCCCTGGGAGAGCTGGCGGCAGG + Intergenic
985644238 5:1077613-1077635 GCTCGGAGGGACCTGCAGGCAGG + Intronic
985758311 5:1732364-1732386 GCCTGGTGGGAGCTGGCGAAGGG - Intergenic
990557619 5:56951821-56951843 AGCCGGACGGAGGTGGCGGCCGG - Intronic
992716233 5:79513981-79514003 GCCCGGCGGTAGCCGGAGGCGGG - Exonic
992939742 5:81750761-81750783 GGCCGCAGGGGGCTGTCGGCGGG - Intronic
995484199 5:112622564-112622586 GTCCAGAGGGAGGTGGCTGCAGG - Intergenic
996777530 5:127148815-127148837 GCCCAGAAAGAGCTGGAGGCTGG - Intergenic
996937410 5:128965192-128965214 CCCAGGGAGGAGCTGGCGGCGGG + Exonic
1000052686 5:157575888-157575910 GCCCGGAGGGGGCTGGAGGGAGG + Intergenic
1000318931 5:160118774-160118796 GACCGGAGGGTGCTGGGGGCGGG + Intronic
1001382131 5:171311865-171311887 GCCCGGGGGGTGCGGGCGGGGGG - Exonic
1001761497 5:174211718-174211740 GCCCAGAGGGATGTGGGGGCTGG - Intronic
1002297066 5:178237681-178237703 GCCAGGATGGAGCTGGTTGCTGG + Exonic
1002447374 5:179297752-179297774 GCCCTGAGGGAGCTGGTGGTGGG - Intronic
1002447846 5:179301011-179301033 GCCAGGAGGGGGCTGGCCGCCGG - Intronic
1002582160 5:180215484-180215506 GCCCGAAGGGACCTGGCAGGTGG + Intergenic
1002663030 5:180803749-180803771 GGCCGGAGGGAGCTGGGCGAGGG - Intronic
1003202327 6:3973325-3973347 GCCCTGTGGGAGGTGGAGGCGGG + Intergenic
1003603825 6:7542096-7542118 GCCCGGAGAGCGCGGGCTGCGGG + Intronic
1003865306 6:10357540-10357562 GGCCGGAAGGAGTTGGGGGCTGG + Intergenic
1005063495 6:21797313-21797335 GCCCGGAGGGAGCGGCTGGCCGG + Intergenic
1006137048 6:31901739-31901761 GCACGGTGCGTGCTGGCGGCGGG - Intronic
1006340444 6:33443675-33443697 GCCCTGAGGGGGCTGGCCTCTGG - Exonic
1006518229 6:34556221-34556243 GCTTGCAGGGAGCTGGCAGCAGG + Exonic
1006750486 6:36373645-36373667 GCCCTGAGGCAGGTGGCTGCAGG - Intronic
1006891555 6:37433395-37433417 GCCCGGGGGGAGCAAGCGGGCGG + Intronic
1007109377 6:39304185-39304207 GAGCCGAGGGAGCTGGAGGCAGG + Intronic
1007111852 6:39317420-39317442 ACCCTGAAGGAGCTGGCAGCTGG - Intronic
1008277476 6:49558321-49558343 GCATGGGGGGAGCTGGAGGCAGG + Intronic
1011765028 6:90611100-90611122 GCCGGGAAGGAGCCGGCGCCAGG + Intergenic
1012795039 6:103748924-103748946 GCCCTGAGGGAGCAGGCAGATGG - Intergenic
1012939620 6:105403000-105403022 GGCCGGCGGCAGCGGGCGGCCGG + Exonic
1013048899 6:106512699-106512721 GCCCGGGGGCCGCTGGCGGGCGG - Exonic
1013078677 6:106793355-106793377 GCCATGAGGGAGCTGGGGGGAGG - Intergenic
1014798931 6:125756269-125756291 TCAAGAAGGGAGCTGGCGGCTGG + Intronic
1017719758 6:157236233-157236255 GCGCCGGCGGAGCTGGCGGCAGG + Intergenic
1018017818 6:159727620-159727642 GCCCGGGGGGCCCGGGCGGCAGG + Intronic
1019299148 7:294851-294873 GACCGGAGGGAGGTGCAGGCAGG + Intergenic
1019778355 7:2925589-2925611 GCCCCGACAGAGCTGGCAGCAGG - Intronic
1022104437 7:27188225-27188247 GCCCGGAGGGACTTGCCGCCCGG + Intergenic
1023810363 7:43906657-43906679 TCCCGGAGCGGGCGGGCGGCCGG - Exonic
1024085539 7:45889033-45889055 GCCGGGCGGGGGCGGGCGGCAGG - Intronic
1024537612 7:50450789-50450811 GCAGGCAGGGAGCGGGCGGCGGG + Intronic
1025829786 7:65038705-65038727 GCCGGGTGGGGGGTGGCGGCGGG + Intergenic
1027223274 7:76227543-76227565 GCTGGGAGGGAGCAGGAGGCAGG - Intronic
1028121303 7:87059331-87059353 GCAAGGAGGAAGCGGGCGGCTGG + Exonic
1029640268 7:101815948-101815970 GCCAGGAGGCAGCAGGCGGGCGG - Intronic
1031369822 7:120951002-120951024 GGCGGGAGGGAGGGGGCGGCGGG + Intronic
1032508331 7:132452595-132452617 GCCCCCAGGGAGCTGGGAGCTGG - Intronic
1032584055 7:133130221-133130243 GCAGGGAGGGAGCTGGTGGGAGG + Intergenic
1033162695 7:139011465-139011487 GACTGGAAGGAGCTGGGGGCTGG - Intergenic
1033328487 7:140398492-140398514 GCCAGGGGTGAGCTGGCGGCGGG - Exonic
1034448589 7:151125837-151125859 GCTGGGAGGGAGGCGGCGGCGGG + Intronic
1034781496 7:153886552-153886574 GCCCGGAGGGAAGTGGAGGCCGG + Intergenic
1035978210 8:4336774-4336796 GCCCAGAGGGAGATGCCGCCTGG + Intronic
1036097345 8:5738737-5738759 GGCGGGTGGGAGGTGGCGGCGGG - Intergenic
1036482651 8:9151730-9151752 GCCCGGAGTGATCCGGCTGCGGG + Exonic
1037769212 8:21789162-21789184 GAGCCGAGGGAGCCGGCGGCTGG - Intronic
1039936561 8:42051570-42051592 GCCCTGGGGGAGCCGGCGGGTGG - Intronic
1040555071 8:48471165-48471187 GCCAGGAGAGAGCAGGCAGCTGG + Intergenic
1041689892 8:60678672-60678694 GCCCGGAGGGAGCTGGCGGCGGG + Intergenic
1041929931 8:63275860-63275882 CCCCGGAGGTAGCTGGGTGCAGG - Intergenic
1043002080 8:74771830-74771852 GCCCAGAGGGAGCTGGTCCCCGG + Intronic
1043463953 8:80486951-80486973 GCGCGGGCGGCGCTGGCGGCGGG - Exonic
1045583137 8:103500509-103500531 GACTGGAGGGAGCAGGCGGGAGG - Intergenic
1046131901 8:109975779-109975801 GCCCGGAGGGAGGTGGAGGCGGG - Exonic
1047381970 8:124372419-124372441 GCCCGGAGAGGGCGGGCGGTCGG + Exonic
1047402394 8:124557765-124557787 GACCCGAGGGAGCAGGCGGGAGG + Exonic
1048282195 8:133113859-133113881 GCCATGAGGGAGCTGTCGGAGGG + Intronic
1048994946 8:139788474-139788496 GCCTGGAGGGTGCTGGCACCAGG - Intronic
1049015106 8:139914475-139914497 GCGCAGCGGGAGATGGCGGCAGG + Intronic
1049406269 8:142453008-142453030 GGCGGGAGGGAGGTGGCGGCCGG - Intronic
1049415142 8:142491649-142491671 GCTCGGAGGAGGCGGGCGGCAGG - Intronic
1049419362 8:142510237-142510259 GCCCGTAGACAGCGGGCGGCTGG + Intronic
1049761729 8:144334708-144334730 GGCCGGAGGGAACTGGGGGAGGG - Intronic
1051697960 9:19789082-19789104 GCCCAGAGGGAGGGGCCGGCGGG - Intergenic
1053306125 9:36986045-36986067 GGTCGGACGGAGCTGGCGTCGGG - Intronic
1053312361 9:37027713-37027735 GCCCGGAGGGAGCTGAGCCCCGG - Intronic
1053799203 9:41753856-41753878 GCATGGGGGGTGCTGGCGGCAGG - Intergenic
1054146009 9:61561143-61561165 GCATGGGGGGTGCTGGCGGCAGG + Intergenic
1054984727 9:71248307-71248329 GACCCGAGGGAGTTGGCTGCAGG + Intronic
1056143508 9:83707456-83707478 GCCGGGATGGGGGTGGCGGCAGG - Intronic
1056992684 9:91425112-91425134 ACCAGGAGGGAGCTGGCTGGTGG - Intergenic
1057197267 9:93122001-93122023 GCCAGGAGGGAGCTGCCTCCTGG + Exonic
1057716666 9:97501555-97501577 GGAAGGAGGGAGCCGGCGGCGGG + Intronic
1058908106 9:109497953-109497975 GGCCGGGGCGGGCTGGCGGCCGG - Intronic
1059251507 9:112891034-112891056 GCCCCGGGGGTGCTGGCGCCAGG - Intergenic
1059338006 9:113581074-113581096 GGCCCCAGGGAGCTGGCTGCAGG + Intronic
1060423814 9:123488245-123488267 GCTCGGAGGCAGCTGGGGGAGGG - Intronic
1060795220 9:126508431-126508453 GGCTGCAGGGAGCTGCCGGCGGG - Intergenic
1060941474 9:127545391-127545413 GCCTGGCGGGAGCTGGGTGCTGG - Intronic
1060991949 9:127854450-127854472 ACCCGAGGGGAGCAGGCGGCCGG + Exonic
1061163794 9:128911056-128911078 GCACGGAGGGAGGTGGCCCCTGG + Intronic
1061163808 9:128911108-128911130 GCACGGAGGGAGGTGGCCCCTGG + Intronic
1061935554 9:133855632-133855654 GTGCGGGGGGAGCTGGTGGCGGG - Intronic
1062064352 9:134518179-134518201 GCCTGGTGGGCGCTGGCGCCGGG + Intergenic
1062090004 9:134670953-134670975 GCCGGGAGGGAGCTGATGTCTGG + Intronic
1203771069 EBV:50442-50464 GCCACGGGGGCGCTGGCGGCCGG - Intergenic
1186483365 X:9913091-9913113 TCCCCGAGGGAGCTGGCTGGAGG + Intronic
1186514579 X:10156951-10156973 GCCCGGAGGGCCCCGGAGGCCGG - Intronic
1188540853 X:31248833-31248855 GCTCCGAGGGAGCTGGAGCCAGG - Intronic
1191850249 X:65581021-65581043 GCCCTGAGTGAGCTGGCTGCTGG - Intergenic
1193130056 X:77910501-77910523 GCCCGGGGGCAGCAGGGGGCAGG + Intergenic
1196961548 X:121008499-121008521 GCCCTGAGCTAGCTGGTGGCTGG + Intergenic
1200235965 X:154467839-154467861 GCCATGATGGGGCTGGCGGCGGG + Exonic
1200448438 Y:3293922-3293944 GCCTGGAAGAAGCTGGCGGACGG - Intergenic