ID: 1041690086

View in Genome Browser
Species Human (GRCh38)
Location 8:60679360-60679382
Sequence CCGCGCGCCCCCGCCGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 743
Summary {0: 1, 1: 4, 2: 21, 3: 91, 4: 626}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041690086_1041690092 11 Left 1041690086 8:60679360-60679382 CCGGCGGCGGCGGGGGCGCGCGG 0: 1
1: 4
2: 21
3: 91
4: 626
Right 1041690092 8:60679394-60679416 GTCACTTCCTCGCATGTAAATGG No data
1041690086_1041690094 30 Left 1041690086 8:60679360-60679382 CCGGCGGCGGCGGGGGCGCGCGG 0: 1
1: 4
2: 21
3: 91
4: 626
Right 1041690094 8:60679413-60679435 ATGGCTTTTTGTTGTGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041690086 Original CRISPR CCGCGCGCCCCCGCCGCCGC CGG (reversed) Intronic
900247238 1:1642419-1642441 CAGCCCGCCTCGGCCGCCGCGGG - Exonic
900258462 1:1709551-1709573 CAGCCCGCCTCGGCCGCCGCGGG - Exonic
900578036 1:3393998-3394020 CCTGGAGCCGCCGCCGCCGCGGG - Intronic
901017937 1:6242377-6242399 GCGCCCGCCCCCGCCCCCTCGGG - Intergenic
901084641 1:6603023-6603045 GCGCCCGCCCCCGGCTCCGCAGG + Intronic
901109783 1:6785472-6785494 CCTCGTACCGCCGCCGCCGCCGG - Exonic
901425951 1:9182560-9182582 CCCCTCGCCCACGCCGCCGCTGG + Intergenic
901443536 1:9293314-9293336 CCCCGCGCTGCCGCCGCTGCAGG + Intronic
901551317 1:9997724-9997746 CCGGGCGCCCCCTCCCCGGCCGG - Intronic
901629026 1:10639249-10639271 CCGCCCGACGCCGCCGCCCCCGG - Exonic
901659088 1:10787505-10787527 CCGCCCGCCCCCCTCGCCCCCGG - Intronic
901676572 1:10889013-10889035 CCGCCCGCCCCGGCCGCCCAGGG - Intergenic
902053736 1:13583775-13583797 CCCCGCTCCCCCGCCTCCTCGGG + Exonic
902375135 1:16026923-16026945 CCGCCCCGCCCCGCCGCCCCCGG - Intronic
902584985 1:17433413-17433435 CCGCCCTGCCCCGCCGCCCCGGG - Intronic
902768299 1:18631230-18631252 CCCCGGCCCCCCTCCGCCGCGGG + Exonic
902870739 1:19312277-19312299 CCGCGCGCCACCGCCCCCGCGGG - Intergenic
903349952 1:22711328-22711350 CCACGCGCGCTCGCCGCCCCCGG + Intronic
903398408 1:23020008-23020030 CCGCCCTCCCCCGCCGCCGCCGG + Intronic
903485696 1:23688318-23688340 CGGCGCGCGCCCGCAACCGCAGG - Intergenic
904037924 1:27568697-27568719 CCGGGCACCCGCGCCGCGGCCGG - Intronic
904181396 1:28668986-28669008 GTGCGTGCCGCCGCCGCCGCCGG + Intronic
905639187 1:39576822-39576844 CCGCCCGCCCCGGGCGCTGCTGG + Intergenic
905647211 1:39633049-39633071 CGGCCCAGCCCCGCCGCCGCCGG - Intronic
906640701 1:47438966-47438988 CGGCGCACCCCCGCCGGGGCCGG + Exonic
907051198 1:51330679-51330701 CCGCGCTCCCGCACCGCCGGGGG + Intronic
907278003 1:53327612-53327634 CCTCGGCCCCCCGCCCCCGCGGG - Intronic
907540880 1:55214901-55214923 CCGCGGGCCCCCGCCGGGCCCGG + Exonic
907962523 1:59296773-59296795 GCGCGCGATCCCGCCCCCGCCGG - Intronic
908527586 1:65002690-65002712 GCCCCCGCCTCCGCCGCCGCCGG - Intergenic
912505051 1:110150610-110150632 CCGCGCGCTCTCTCCGCCGTGGG + Exonic
914134091 1:144883703-144883725 CCCCCCCCCCCCGCCGCCTCGGG - Intergenic
914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG + Intronic
915070346 1:153261152-153261174 GCCCCCGCCCCCGCCGCCGGAGG - Exonic
917788858 1:178486925-178486947 TCGCGCGCTTCCGCCTCCGCGGG - Intergenic
917846694 1:179026020-179026042 CCGGCCGCCCCCGCCGCCTCCGG - Exonic
918015953 1:180632458-180632480 CCCCGCAGCCCCGCTGCCGCCGG + Intronic
920021284 1:202958287-202958309 TCGCGCGCCCCTTCCGGCGCGGG - Exonic
921384073 1:214551822-214551844 GCGCGCGCCCGCGGCGCCCCCGG - Intronic
921604757 1:217139698-217139720 CCGCGCACCGCCGCCGCCGCCGG - Intergenic
922250593 1:223845857-223845879 CCGGGCTCCCCCGCCCCGGCCGG + Exonic
922739419 1:228007004-228007026 ACCCGCGCACCCGCGGCCGCAGG + Intergenic
922753535 1:228082155-228082177 CCGCGCGTCACTGCGGCCGCCGG + Intergenic
922753738 1:228082873-228082895 CCTGTCGCCGCCGCCGCCGCGGG - Intronic
922958587 1:229625909-229625931 CCCCCCGCCGCCGCCGCCTCCGG + Exonic
923007920 1:230067082-230067104 CCGCGCGGCGCCGCCGGCCCGGG + Intronic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
923171666 1:231422311-231422333 CCGCCCGCCCGGGTCGCCGCGGG - Exonic
923191769 1:231626886-231626908 CAGGGCGCCCCAGCCGCCGCCGG + Exonic
924172416 1:241356678-241356700 CCCCGCGCCGCGGCGGCCGCCGG + Intronic
924436681 1:244048904-244048926 CCGGCCGCCGCCGCCGCCGCCGG - Intergenic
924511202 1:244730459-244730481 CCGCGCGCCAGCCCCGCCGCCGG - Intergenic
924613173 1:245590294-245590316 CCGCGGGGCCCAGCCGCCCCGGG - Intronic
924835078 1:247639524-247639546 GCGCGCGCCTCTGCCGCAGCCGG - Intergenic
1063657793 10:8009211-8009233 CTGCTCGCCCAGGCCGCCGCGGG + Exonic
1064209078 10:13348112-13348134 CCCGCCGCCGCCGCCGCCGCCGG - Exonic
1064443108 10:15371066-15371088 CGGCGAGCCCGAGCCGCCGCCGG - Intergenic
1064553116 10:16521722-16521744 GTGCCCGCCGCCGCCGCCGCTGG - Exonic
1064982007 10:21174338-21174360 CCTCGCGCCACCGCCGCTGCAGG + Intergenic
1065140464 10:22714418-22714440 CGGCGCGCCGGGGCCGCCGCCGG - Exonic
1065214940 10:23439716-23439738 GCGCCCGCCTCCGCCGCCGCCGG + Exonic
1065390076 10:25174574-25174596 TCCCGCGCCCCCGCCGCCCGCGG + Intergenic
1065712734 10:28533158-28533180 CCCGCCGCCGCCGCCGCCGCTGG - Intronic
1066022836 10:31319811-31319833 CCGCGCGCCGCGGCCCCGGCCGG + Intronic
1066023082 10:31320830-31320852 CCCTGCGCTCCCGCCGCCCCCGG - Intronic
1066464202 10:35639453-35639475 GCCCGGCCCCCCGCCGCCGCCGG + Exonic
1067362416 10:45594709-45594731 CCGCGCGCAGCCGCCGCCGCTGG - Intronic
1069544540 10:69319015-69319037 GCCCCCGCCCGCGCCGCCGCTGG + Intronic
1069623607 10:69852999-69853021 CCCCGCTCCCCCGCCCCAGCTGG - Intronic
1070140238 10:73733152-73733174 CCGCGCGCCCACGGCCCTGCGGG + Intergenic
1070768311 10:79068816-79068838 CGCCGCGCCGCCGCCGCTGCCGG - Intergenic
1070768407 10:79069240-79069262 GCGAGCGCCGCTGCCGCCGCTGG - Exonic
1070800833 10:79243558-79243580 CCCCGCGCCGCCGCCGCCGCCGG + Intronic
1070800860 10:79243659-79243681 TCGCTCGCCGCGGCCGCCGCCGG + Intronic
1071997555 10:91162973-91162995 CGCCCCGCCCCCGCCGGCGCGGG + Intergenic
1072591630 10:96832735-96832757 CGGCGCCCCGGCGCCGCCGCCGG + Intronic
1072650628 10:97292417-97292439 CCCCGCGCCTCAGCCCCCGCAGG + Intronic
1072654623 10:97321174-97321196 ACGCGCGTCGCCGCCACCGCGGG + Exonic
1073123342 10:101134932-101134954 CCGCGAAACCCCGCCGCAGCCGG - Intronic
1073325758 10:102643464-102643486 CGGCCTGGCCCCGCCGCCGCAGG + Intergenic
1073812433 10:107164952-107164974 CTCTGCGCCCCCGCGGCCGCGGG + Intergenic
1073921735 10:108466638-108466660 CTCTGCGCCCCCGCAGCCGCGGG + Intergenic
1074169721 10:110919955-110919977 CCGCCCGCCGCCGCCGCCGCAGG - Intronic
1074182920 10:111078879-111078901 TCGCGCGGCCCGGCCGGCGCGGG - Exonic
1074865721 10:117543424-117543446 TCGGCCGCCGCCGCCGCCGCCGG + Exonic
1075697487 10:124447628-124447650 CCGCCGCCCCCCGCCGCCCCTGG + Exonic
1076554275 10:131311787-131311809 GCCCGCGCCGCCGCCGCCCCCGG + Intergenic
1076792729 10:132785644-132785666 CCGCGCGCCACAGCGGCCGCGGG + Exonic
1076999596 11:315989-316011 CCGCGCACCCCCGACGCCCGTGG - Intergenic
1077090859 11:777617-777639 CCGCGCGCCCGGGCGGTCGCAGG + Exonic
1077121466 11:910855-910877 CCGCGCGCCGCCGCCGCGCACGG + Intronic
1077250153 11:1557300-1557322 CCCCGCGCCCCCCACGCCCCCGG - Exonic
1077898785 11:6473906-6473928 CCCCGCGCCGGCGCCGCCGCCGG + Intronic
1079451181 11:20601174-20601196 CCCTGCGCCGCCGCCGCCTCCGG - Exonic
1080802101 11:35618652-35618674 CGGGGCGCCGCCGCCACCGCGGG + Exonic
1081528520 11:43942875-43942897 CCGCCCGGCCCCGCAGACGCCGG + Exonic
1081705654 11:45180857-45180879 CCGCGCGCCCCCGGCCCTGCTGG + Intronic
1081831458 11:46119869-46119891 CCGCGCGCCCCTCCCCCCGGCGG + Intronic
1082986082 11:59172363-59172385 CCGCGCGCCGCCGCCGCCGCCGG - Intronic
1083039127 11:59669081-59669103 CCCTGCGCAGCCGCCGCCGCCGG - Intergenic
1083270076 11:61567751-61567773 CCGCTGGCCCAGGCCGCCGCTGG - Intronic
1083448511 11:62726998-62727020 GGGCCCGGCCCCGCCGCCGCCGG + Exonic
1083644921 11:64166415-64166437 CGGCGCGCCTGCTCCGCCGCGGG - Intergenic
1083670942 11:64299674-64299696 CCGTGCGGCCCCGCGGCCCCGGG + Exonic
1083741532 11:64713894-64713916 CGGCGCCCCTCCCCCGCCGCGGG + Exonic
1083970303 11:66070404-66070426 GCCCCCGCCGCCGCCGCCGCGGG + Intronic
1084028485 11:66467159-66467181 CCGCGCGTCCCTGCGGTCGCGGG + Intronic
1084387745 11:68854790-68854812 CAGGGCGCCCGCGCAGCCGCGGG + Intergenic
1084516330 11:69639598-69639620 TCCCGCGCCCCCTCCCCCGCCGG - Intergenic
1084650281 11:70485534-70485556 GCCCGCTCCCCCGCCCCCGCCGG - Intronic
1084665339 11:70573312-70573334 CCGCCCCCCCCCCCCACCGCTGG - Intronic
1084814820 11:71639793-71639815 CCCCGCGCCCCCGGCACCCCCGG - Intergenic
1084973123 11:72781943-72781965 GCGCCCGCCCCCGCCGGCCCTGG + Intronic
1085205829 11:74731361-74731383 CGCCGCGCCGCCGCCGCTGCTGG - Intronic
1085333045 11:75668677-75668699 CTGTGCGCCGCCGCAGCCGCAGG - Exonic
1088481065 11:110296702-110296724 CTGAGCGCCAACGCCGCCGCTGG + Exonic
1088919414 11:114250563-114250585 CCGCTCGGCTCCACCGCCGCGGG - Exonic
1089432653 11:118436559-118436581 CCCCCCGCCGCCGCCGCCCCCGG - Exonic
1089499819 11:118925506-118925528 CCCCGCGCCCCGGCCCCGGCGGG - Intronic
1089499924 11:118925843-118925865 CCGCGCGCCGCCGCCTCCCCGGG + Intronic
1090003976 11:122984278-122984300 CCCCGCTCCCGCGCTGCCGCCGG + Intergenic
1090699313 11:129279631-129279653 AGGCGCGCCGCCGCGGCCGCGGG + Intergenic
1090780385 11:130002208-130002230 GCCCGCGCAACCGCCGCCGCCGG + Intronic
1090799084 11:130159671-130159693 CTGCCCGCCCCCGCCGGCCCTGG - Exonic
1091001133 11:131911349-131911371 CCGCGCCTCCCGGTCGCCGCGGG + Intronic
1091219160 11:133920249-133920271 CCGTGCGCCCCCGGCTCAGCCGG + Exonic
1091286786 11:134412355-134412377 CCTCGCGCCCCCGCCTAGGCTGG - Intergenic
1091616109 12:2052652-2052674 CCGCGCGCCCCGGCCTCCCCGGG + Intronic
1092615637 12:10213258-10213280 CTACCCGCCCCCGCCCCCGCGGG - Intronic
1093894821 12:24563339-24563361 CCGCGCGTCCCCGCCGCCGCCGG + Intergenic
1094025802 12:25958831-25958853 CCCAGCGCCAACGCCGCCGCGGG - Intergenic
1096073569 12:48788937-48788959 CCCCGCCCCGCCGCCCCCGCGGG + Intronic
1096101235 12:48971608-48971630 CCCAGCGCCGCCGCGGCCGCCGG + Exonic
1096127678 12:49131489-49131511 CCGCGCGCCCACTCCGCGCCCGG + Intergenic
1096241182 12:49961305-49961327 CCGCCCGCCCCCGCCGCCGGCGG + Intergenic
1096389585 12:51218086-51218108 CCGCCCGCGCCAGCCGCCGGGGG + Intergenic
1096460876 12:51821001-51821023 GCGCGCGCCCTCGGCGGCGCCGG + Intergenic
1096983627 12:55743152-55743174 GCCCGCGCGCCCGCCGCCCCCGG + Intergenic
1097166497 12:57089049-57089071 CTCCGCGCCTCCGCCCCCGCAGG - Exonic
1097925435 12:65121610-65121632 CCTCGCGGCCCCGCCCCCGGGGG - Intergenic
1098024715 12:66189452-66189474 CTGGGCTCCCCCGCCGCCCCCGG - Intronic
1098161045 12:67648661-67648683 CCGCCCTCCTCCGCCGCCGCAGG - Intronic
1098255379 12:68610841-68610863 CCGCGCGCCCCGCCCGCGGGCGG + Exonic
1098550373 12:71755140-71755162 CGCCCCGCCGCCGCCGCCGCCGG - Exonic
1098991162 12:77065810-77065832 ACGCGGGCCCCGGCGGCCGCGGG + Intergenic
1100260661 12:92929343-92929365 CCCCGCCCCCCGGCGGCCGCGGG - Intergenic
1100444816 12:94650580-94650602 CCCTGCGCCGCCGCCGCCGCGGG + Intergenic
1100632292 12:96400594-96400616 GCCCCCGCCTCCGCCGCCGCCGG - Intergenic
1103074267 12:117969309-117969331 CCGGCCTCCCCCGCCGCCCCCGG - Intergenic
1103364016 12:120369340-120369362 CCCGGCGCCGCCGCCTCCGCGGG - Intergenic
1103432965 12:120903910-120903932 CCGAGCGAGCCCGCCGCCGCCGG - Exonic
1103595358 12:122021826-122021848 AGCCGCGCCGCCGCCGCCGCCGG - Exonic
1103604880 12:122079018-122079040 CGCCGCGCCACCGCCGCCTCGGG + Exonic
1103649636 12:122422629-122422651 TGACGCGCCGCCGCCGCCGCGGG + Intronic
1103779431 12:123389198-123389220 CCGCCCGCCCCCCGCGCGGCCGG - Intronic
1104021175 12:124993582-124993604 CCGCGCCCCGCCCCCGGCGCGGG - Intergenic
1104983383 12:132583608-132583630 CCGCCCGCCGCCGCCGCCCTCGG + Exonic
1105000423 12:132687092-132687114 CGGCGCGCCCCGACCGCCGACGG - Intronic
1105964528 13:25372323-25372345 CCCCGCGCCGCCCCCGCCCCGGG - Intronic
1107133329 13:36919687-36919709 CCGACCGCCGCCCCCGCCGCGGG + Intronic
1107467794 13:40665785-40665807 CCGGTGCCCCCCGCCGCCGCTGG - Exonic
1107935225 13:45340845-45340867 CCGCGTGCGGCCGCCGGCGCGGG - Intronic
1110436461 13:75482095-75482117 CCGAGGGTCCCCGCGGCCGCCGG + Exonic
1111556187 13:89884091-89884113 CCGGCCGACCCCGCCGCCCCAGG - Intergenic
1112344354 13:98577304-98577326 CGGCGCTCCCACGCCCCCGCGGG + Intronic
1112505081 13:99970583-99970605 CCCGGCGCCGCCGCCGCCGCCGG - Exonic
1112505439 13:99971936-99971958 CTTCGCGCCCCCTCCTCCGCTGG + Intergenic
1112506785 13:99980632-99980654 CCGCGCCCCCGCCCCGCTGCCGG - Intergenic
1112693052 13:101917158-101917180 CCGCGGGCCGGTGCCGCCGCCGG + Intronic
1113200997 13:107867341-107867363 CCGCCCGCGGGCGCCGCCGCCGG + Intergenic
1113768371 13:112894419-112894441 CCGCGCGCACCTGCCGCCCGTGG - Intronic
1115235871 14:31207914-31207936 GCTCTCGCCCCCGCCGCCTCGGG + Intergenic
1117251860 14:53946863-53946885 CCTGGTGCCCCCGCCGCCGCCGG + Intergenic
1117740741 14:58816839-58816861 CGGCGAGCCCCCTCCCCCGCAGG + Intergenic
1117899251 14:60515563-60515585 GCGCGCGCCTCCGCAGCTGCAGG - Intergenic
1117912442 14:60648552-60648574 CCGCCCCCTCCCGCCCCCGCAGG - Intronic
1118404807 14:65412732-65412754 TCGCGCGCGCACGCCGGCGCTGG + Intronic
1118808913 14:69260009-69260031 CCCCGCGCTCCAGCCGCCGCCGG - Exonic
1118809008 14:69260391-69260413 CTGCGCGCCCCGGCCGCCGGAGG - Exonic
1118849302 14:69572293-69572315 CCGCCCGCTCCCGCCGCAGGAGG + Exonic
1119802375 14:77457527-77457549 GCGCCAGCCTCCGCCGCCGCTGG + Exonic
1121050452 14:90816362-90816384 CCGCCTCCCGCCGCCGCCGCGGG + Exonic
1122081807 14:99272040-99272062 CAGCGCTCCCCTGGCGCCGCGGG + Intergenic
1122145124 14:99684311-99684333 CCGCGCGCCGCCTCGGCCCCAGG - Exonic
1122194365 14:100074001-100074023 CCCCCCGCCCCCACCGCCCCCGG - Intronic
1122231201 14:100306983-100307005 CCGGAGGCCACCGCCGCCGCGGG - Intergenic
1122582222 14:102777823-102777845 CCGCGCCCCGCCGTCGCCGCTGG - Intronic
1122779873 14:104139063-104139085 CCGCGAGCCGCCGCCGCTGCTGG + Exonic
1122982051 14:105196436-105196458 CCACCCGCCCCCAGCGCCGCAGG + Intergenic
1123024924 14:105420006-105420028 CCGGGCCCCTCCGCCGCCGCCGG + Exonic
1123024986 14:105420167-105420189 CCGCCCGCCCTCGCGGCCCCCGG + Intronic
1124500375 15:30223087-30223109 CCGCCCTCCTCCGCCGCCTCCGG - Intergenic
1124500728 15:30225039-30225061 CCCGCCGCCGCCGCCGCCGCAGG + Intergenic
1124742841 15:32313628-32313650 CCCGCCGCCGCCGCCGCCGCAGG - Intergenic
1124743198 15:32315579-32315601 CCGCCCTCCTCCGCCGCCTCCGG + Intergenic
1124929145 15:34101890-34101912 CCGGCCGCCACCGCCGCCGCTGG + Exonic
1125462683 15:39920999-39921021 CCTCGCGCCCAGGCTGCCGCGGG + Intergenic
1125516460 15:40323833-40323855 GCCAGCGCCGCCGCCGCCGCCGG - Intergenic
1125717455 15:41827429-41827451 GGGCCCGCCCCCGCCGCCGCGGG - Exonic
1126348358 15:47718829-47718851 CCGCTCGCGCCGGCAGCCGCTGG + Exonic
1126626059 15:50686759-50686781 GCGCCCGCGCCCGCCTCCGCCGG + Exonic
1127606315 15:60591841-60591863 CCGAGCGCCTCAGCGGCCGCCGG - Intronic
1128992493 15:72272515-72272537 CCGCGCGCGGCCGCAGCCGACGG + Exonic
1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG + Intergenic
1129199876 15:73992336-73992358 TCCTGCGCCCGCGCCGCCGCGGG - Exonic
1129862395 15:78872789-78872811 CCCTGCGCCCGCGCCGCCCCAGG - Intronic
1130076511 15:80695031-80695053 CCGCGCGGCGGCGCCGCCGCTGG - Intronic
1130411771 15:83654001-83654023 CGGCGCGCGCCCTCCGCCTCTGG + Intergenic
1131048652 15:89332595-89332617 CCCCGCCCCCCTGCCCCCGCCGG - Intronic
1131517612 15:93089322-93089344 CCGCGCGCGCCCCCCGCCCGCGG - Intergenic
1131635714 15:94231415-94231437 CCAAGCGCCCGCGCTGCCGCCGG - Intergenic
1132527720 16:425905-425927 GCGCCCGCCCGCGCCGCCGAGGG + Exonic
1132589788 16:721602-721624 CCGCGCGCTCGCGCCGACGTAGG - Exonic
1132604589 16:788429-788451 CGGCCCGCCCCCGCCGCGGAAGG + Intergenic
1132656571 16:1044053-1044075 ACCGGCGCCCCCGCCGCCGCCGG - Intergenic
1132719686 16:1309616-1309638 CCGCGCGCCCCGCCCGCGCCAGG + Intronic
1132719808 16:1309979-1310001 CCGAGCGGCCGGGCCGCCGCAGG + Intronic
1132843533 16:1989934-1989956 CCGCGCGTCCCCGCCGCGGCCGG + Exonic
1132889544 16:2196912-2196934 CCCCGCGCCGCCGCCGCGTCGGG - Intergenic
1132900445 16:2251362-2251384 CCGCGCGCCGTCTCCGCCGCCGG + Exonic
1132900944 16:2253994-2254016 CCCCGGGCCGCCGCCGCCACAGG - Exonic
1132932914 16:2467915-2467937 CCACGAGCCCCCAGCGCCGCCGG - Intergenic
1133020194 16:2963737-2963759 CCGCACGCCCCTCCCGCCCCTGG - Intergenic
1133156453 16:3880137-3880159 CCGGCCGCCGCCGCCGCCGCCGG + Exonic
1133188364 16:4116063-4116085 CCCCCAGCGCCCGCCGCCGCGGG - Exonic
1133188430 16:4116292-4116314 CCGCCCGCCCGCGCCCACGCCGG + Intergenic
1133370058 16:5240129-5240151 CCCCGCGCCCCCGGCACCCCCGG - Intergenic
1133771479 16:8869104-8869126 CCGCCCGCCCCCACCGTCCCGGG - Intergenic
1133784292 16:8963170-8963192 CCCCCCGGCCCCGCCGCGGCCGG + Intronic
1134614892 16:15643265-15643287 CCGCGAGGCCCCGCCCCCCCCGG - Exonic
1136428369 16:30183797-30183819 CCGCGCGCCCCCGCAGCCCGCGG - Intronic
1136540222 16:30924379-30924401 CCCGGCCCCCCCGCCGCCGATGG + Intronic
1136696555 16:32085631-32085653 CTTTTCGCCCCCGCCGCCGCAGG - Intergenic
1136784286 16:32925525-32925547 CCCACAGCCCCCGCCGCCGCCGG - Intergenic
1136797056 16:33028915-33028937 CTTTTCGCCCCCGCCGCCGCAGG - Intergenic
1136885498 16:33928281-33928303 CCCACAGCCCCCGCCGCCGCCGG + Intergenic
1136891520 16:33975573-33975595 CCGCGGGCCCCGGCCGGGGCCGG + Intergenic
1137261113 16:46830945-46830967 CCCCGGATCCCCGCCGCCGCCGG + Intronic
1137617617 16:49856672-49856694 CCGCGCGCCCCTTCCTCCTCCGG - Intronic
1138178718 16:54928827-54928849 CCGCGCGCGCCGCCCGCCGGGGG - Intergenic
1138471961 16:57245143-57245165 GCGCGCGCCGCCGACGCCGCAGG - Exonic
1138619285 16:58198288-58198310 CCTCGCCCTCCCGCCGCCACAGG + Intergenic
1138655247 16:58487708-58487730 CCGGGCGTCCCCGCCGCAGCAGG + Intronic
1138961734 16:62036329-62036351 CCAAGCTCCGCCGCCGCCGCCGG - Exonic
1139448596 16:67013800-67013822 CCACCCGCCCGCGCCACCGCGGG + Intergenic
1139472132 16:67184022-67184044 CGGCGCGCCCCCGAGGCCACTGG + Exonic
1139534449 16:67562808-67562830 CCCGGCGCCAGCGCCGCCGCCGG + Intronic
1139544791 16:67645115-67645137 CGGCGCGCACCTTCCGCCGCCGG + Exonic
1139754581 16:69132367-69132389 CCGCGCGCCCCGCCCGGCCCCGG + Intronic
1140096969 16:71883835-71883857 CCTCGCCCCCTCGCGGCCGCCGG - Intronic
1141054506 16:80803673-80803695 CCCCGCGCCCCCGGCCCAGCCGG + Intronic
1141184739 16:81779305-81779327 CCGCTCACGCCCTCCGCCGCCGG - Exonic
1141418947 16:83899279-83899301 CCGCGCGGTGCCGCCGACGCCGG + Exonic
1141608626 16:85169377-85169399 CCGTGCGCCCGCGCCCGCGCCGG + Intergenic
1141972355 16:87492477-87492499 CCGGCCGCCCCGGCCGCCCCGGG - Intergenic
1141972388 16:87492559-87492581 CGCCGCGCACCGGCCGCCGCTGG - Intergenic
1141989476 16:87602236-87602258 CGGGGCGCCCCCGCCCCCTCCGG - Intronic
1142130787 16:88430656-88430678 CCGCCCGCCGCCCCAGCCGCCGG - Intronic
1142429733 16:90019535-90019557 CCCGGCGCCCCCCCAGCCGCAGG + Intronic
1203081512 16_KI270728v1_random:1148033-1148055 CCGCGGGCCCCGGCCGGGGCCGG - Intergenic
1203086943 16_KI270728v1_random:1189531-1189553 CCCACAGCCCCCGCCGCCGCCGG - Intergenic
1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG + Intronic
1142762517 17:2050525-2050547 CCCCGCCCCCACGCCCCCGCCGG - Intergenic
1142799775 17:2337813-2337835 CCGCGCCCACCCCCCGGCGCGGG + Intronic
1142811799 17:2399022-2399044 CCGTGTGCCGCCGCCGCGGCGGG - Intronic
1142812602 17:2402137-2402159 CCCCGCGCCCCGCCCACCGCCGG - Intergenic
1143537335 17:7549171-7549193 CCCGGCGCCCCCTCCGCCTCTGG - Exonic
1144269144 17:13600938-13600960 CCCCGCCTCCTCGCCGCCGCCGG + Exonic
1144756184 17:17681838-17681860 CCTCGCGCCGCCCCCGCCCCGGG - Intronic
1144784436 17:17823826-17823848 ACTCGAGCCCCCGCCGCCGTGGG - Intronic
1144813698 17:18018613-18018635 CTGCGGGCCCGCACCGCCGCCGG - Exonic
1145243594 17:21253290-21253312 CCGCGCGCCCCGGCCCCCGCCGG - Exonic
1145327624 17:21844051-21844073 CTTTTCGCCCCCGCCGCCGCGGG + Intergenic
1145694448 17:26775459-26775481 CTTTTCGCCCCCGCCGCCGCGGG + Intergenic
1145709923 17:26962757-26962779 CTTCTTGCCCCCGCCGCCGCGGG + Intergenic
1145925652 17:28644947-28644969 CCCGCCGCCGCCGCCGCCGCCGG + Intronic
1146219837 17:31008725-31008747 CTGCCCGCCGCCTCCGCCGCTGG + Intergenic
1147139700 17:38454113-38454135 CCGCGCGCCCGGGCCGCGCCGGG + Intronic
1147168700 17:38606044-38606066 TCCCCCGCCCCCGCCGCCCCGGG - Intergenic
1147684052 17:42276405-42276427 GCGCGCGCCCCCGCGGGCCCCGG - Exonic
1147710322 17:42458839-42458861 CCCCGCCCCTGCGCCGCCGCCGG - Intronic
1147719837 17:42532249-42532271 CTCCTCGCTCCCGCCGCCGCCGG + Intergenic
1147967000 17:44199252-44199274 CCCCGCGCCCCCTCCCCGGCCGG + Intronic
1148122589 17:45221749-45221771 CAGTTCGCCGCCGCCGCCGCCGG - Intronic
1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG + Intergenic
1148332028 17:46818913-46818935 GCCCGCGCCCCGGACGCCGCGGG + Intronic
1148786908 17:50150035-50150057 CGGAGCGCCCCAGCGGCCGCAGG - Exonic
1148842587 17:50508470-50508492 GCGCACGCGCCCGCCGCCGGCGG - Exonic
1148936229 17:51166400-51166422 CTGCGCCCCTCCTCCGCCGCCGG + Intronic
1150768283 17:68020077-68020099 GCGCGCGCCGCCGCCGCTGGGGG - Intergenic
1150802229 17:68291409-68291431 CGGCGCGCCCCCGAGGCCGGCGG - Intronic
1151156135 17:72123925-72123947 GCAGGCGCCCCCGCAGCCGCAGG + Exonic
1151296858 17:73192576-73192598 TCGGGCGCGCTCGCCGCCGCTGG - Intergenic
1151728224 17:75896641-75896663 CCGCGCGCTGCCCCCGCCACGGG - Exonic
1152433118 17:80260541-80260563 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433131 17:80260571-80260593 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433144 17:80260601-80260623 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433157 17:80260631-80260653 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433170 17:80260661-80260683 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433183 17:80260691-80260713 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433196 17:80260721-80260743 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433209 17:80260751-80260773 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433222 17:80260781-80260803 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433235 17:80260811-80260833 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152541919 17:80981142-80981164 CCCCGCCCCCGCGCCCCCGCGGG + Intergenic
1152581170 17:81166181-81166203 CCGCCCGGCCCTGGCGCCGCGGG + Intergenic
1152781498 17:82229094-82229116 CCGCGCCTACCTGCCGCCGCTGG - Intronic
1152809544 17:82375071-82375093 GCGCGCGCGCCCCCGGCCGCCGG - Exonic
1152823781 17:82450742-82450764 GCGCGCGGCCCCGCCCCCGCCGG - Intronic
1153006226 18:500643-500665 CCGTCCTCCCTCGCCGCCGCCGG + Exonic
1153040808 18:811998-812020 CCGCGGTTCCCCGCCCCCGCGGG - Intronic
1153051921 18:908167-908189 GCGCGCGCCCCCTCGGCGGCCGG - Intronic
1153457234 18:5295285-5295307 CCGCGCGCCGCCCCCGCCCCCGG - Intronic
1153688350 18:7567769-7567791 GCGCGCCCACCCACCGCCGCCGG + Exonic
1153855180 18:9137479-9137501 GGGCGCGCCCCCGCCCCCGCGGG - Intronic
1154173770 18:12068423-12068445 CTCCGCGCCGCCGCCGCCGCCGG + Intergenic
1155053824 18:22169043-22169065 TCCCGCGCCGCCGCCGCGGCGGG - Intergenic
1155152850 18:23136055-23136077 CCTCGCGCCGCAGGCGCCGCCGG - Exonic
1155928813 18:31685102-31685124 CGGCGCCCCGCGGCCGCCGCGGG + Intronic
1156350369 18:36297485-36297507 CCCCGCCCCGCCTCCGCCGCCGG + Intergenic
1156448496 18:37253740-37253762 CCCCGCGCCCCGGCCGCCCCCGG + Intronic
1157794218 18:50559974-50559996 CCCAGCGCCACCGCCGCAGCAGG + Intergenic
1158435948 18:57435679-57435701 CCCGCCGCCCCCGCCGCCCCCGG + Exonic
1158718244 18:59899784-59899806 CCGCGGGTCGGCGCCGCCGCGGG + Intergenic
1158931074 18:62325438-62325460 CCGCGCGGCCCGGCAGGCGCGGG - Intronic
1159241702 18:65750816-65750838 CCGCGCGCTCCCGCTGGCTCCGG + Intronic
1159798108 18:72867793-72867815 CTGAGCCACCCCGCCGCCGCCGG - Exonic
1160453357 18:78979813-78979835 CCGCGCGGCGCCGTCTCCGCCGG - Intergenic
1160453389 18:78979919-78979941 CCGCGCTCCTCGGCCGCCCCGGG - Intergenic
1160592140 18:79951001-79951023 CCGCGCGCTCCTGCGGCCTCGGG + Exonic
1160613950 18:80109701-80109723 CGGCCCGCCCCGCCCGCCGCCGG + Intronic
1160653411 19:246523-246545 CGGCGCGCCGGCGCCGGCGCAGG + Intergenic
1160680345 19:409226-409248 GCCCGCGCCCCCGCCCCCGCGGG + Intergenic
1160691048 19:460833-460855 CCAGCCGCCCGCGCCGCCGCCGG + Exonic
1160767026 19:813247-813269 GCGCGCGGGGCCGCCGCCGCTGG - Exonic
1160873259 19:1286399-1286421 CCCCACGCGCGCGCCGCCGCCGG + Intronic
1160923891 19:1533827-1533849 CCTCCCGCAGCCGCCGCCGCAGG - Intronic
1160930594 19:1568014-1568036 GCCCCCGCCCCCGCCGCCGTCGG + Exonic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1161063597 19:2227152-2227174 CCCCCCGCCCCGGCCCCCGCCGG + Intronic
1161111883 19:2475337-2475359 TGGCGCGGCCCCGCCCCCGCCGG - Intergenic
1161157415 19:2739900-2739922 CCGCCCCGCCCCGCCGCCCCAGG + Intronic
1161203698 19:3029371-3029393 CCCCGCGCCCGCGCCCCCCCCGG + Intronic
1161241156 19:3224699-3224721 CCGCCCGCCGCCGCCGCCGCCGG + Exonic
1161265116 19:3360215-3360237 GAGCGCGCCGCGGCCGCCGCCGG + Intronic
1161350070 19:3786392-3786414 CCGCGCGCCGCCGCCGCCGCCGG + Intronic
1161388098 19:4007637-4007659 GCGCGCGCTCCTCCCGCCGCCGG - Exonic
1161703244 19:5805936-5805958 CTGCTCGCCGCCGCCGCCGCCGG + Intergenic
1161707235 19:5827846-5827868 GCGCACGCGCGCGCCGCCGCCGG - Exonic
1162033205 19:7926051-7926073 CGGGCCGCCGCCGCCGCCGCCGG - Exonic
1162070497 19:8149519-8149541 CCCCGGGTCCCCGGCGCCGCAGG - Exonic
1162128229 19:8510850-8510872 CCGCGCCCCGACGCCCCCGCGGG - Exonic
1162495147 19:11019355-11019377 CCTCAGGCCCCGGCCGCCGCTGG + Intronic
1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG + Intronic
1162951351 19:14073576-14073598 CCGGTCGCCGCCGCAGCCGCTGG + Exonic
1163666624 19:18606661-18606683 CCGCGCGCCCCCGGCAGCGCCGG - Exonic
1163708543 19:18832061-18832083 CCGCGCGCCCCGGCGCCAGCCGG - Exonic
1163760656 19:19134749-19134771 CCGCGGGCCCCTCCCACCGCCGG + Intronic
1165864801 19:38930438-38930460 CTGCGCCCCCCGGCCGGCGCAGG + Intronic
1165871420 19:38975819-38975841 CCGCCCGCCCTCGCTCCCGCTGG - Exonic
1165928697 19:39342687-39342709 CCGCCCGCCGCCGCCGCCCGCGG - Intronic
1165994286 19:39833398-39833420 CCGCTTGCCCTCCCCGCCGCGGG - Exonic
1166091628 19:40513032-40513054 CGGCGAGCGCCCGGCGCCGCTGG + Exonic
1166106683 19:40601235-40601257 ACGCGCCCCCGCGCGGCCGCCGG + Intronic
1166121630 19:40690491-40690513 CCGGGCGCCCCCGCCTCCCGCGG + Exonic
1166375223 19:42324053-42324075 CCCAGCTCCCCGGCCGCCGCCGG + Intronic
1166564340 19:43754596-43754618 CGGAGCGCCCCGCCCGCCGCCGG + Intronic
1166660449 19:44643822-44643844 CCGCGCGCCTGCGCCTGCGCAGG - Exonic
1167643782 19:50695248-50695270 CCCCGCGCCCCCGCGCCCCCCGG - Intronic
1167797487 19:51719372-51719394 CCCACCGCGCCCGCCGCCGCGGG + Exonic
1168056986 19:53869499-53869521 GCCCGCACCCCCGCCCCCGCGGG + Exonic
1168064058 19:53909425-53909447 CCGGCCGCCGCCGCCGCCACCGG - Exonic
1168247049 19:55117610-55117632 CCGCCCGCCCCGGGGGCCGCCGG + Intergenic
1168297302 19:55383736-55383758 CTGCCCGCGCCCGCCGCCCCGGG + Exonic
1168305536 19:55433270-55433292 CAGTGTGCCCCCGCCCCCGCCGG + Exonic
1168309359 19:55452728-55452750 ACGCGCTCCGCCGCCGCCTCCGG - Intergenic
1168343808 19:55641051-55641073 CCCCGCGTCCCCGGCGCCGCCGG + Intronic
925610424 2:5696924-5696946 GGTCGCGCCCGCGCCGCCGCCGG - Exonic
926077377 2:9951935-9951957 CCGCCCGCCCGCGCGGCCTCGGG - Intronic
926202571 2:10812493-10812515 CCGCGCACCCGCACCTCCGCCGG + Intronic
926251096 2:11155790-11155812 CCGCGCGCCGGCGTCGCAGCTGG + Intronic
926581437 2:14634964-14634986 CCACGCGCGTCCGCCGCCGGTGG + Exonic
926901307 2:17754108-17754130 CCGCGCGGCCCCGCCTCTTCCGG - Intronic
927713990 2:25341305-25341327 CCGCTCCCCCGGGCCGCCGCGGG + Intronic
927904616 2:26847942-26847964 CCGCGCGCCGCCGCCGCCTGGGG - Intronic
928094179 2:28393800-28393822 CTGCTGGCCGCCGCCGCCGCTGG - Exonic
929075486 2:38076226-38076248 CGGCGCGCCCCGCCCCCCGCAGG - Intronic
929218038 2:39436856-39436878 CCGCGCGCCGCCGAGGCCGTGGG - Intronic
929218224 2:39437501-39437523 CCGCGCCCGGCCGCTGCCGCCGG + Intergenic
931254055 2:60554965-60554987 CCGCGCTCCCCAGGCGCCGCCGG + Intergenic
931517807 2:63059866-63059888 CCGCCGTCCCCCGCCGCCCCCGG - Intergenic
931602662 2:64019430-64019452 CCGCGCGGCTCCGCCGGGGCGGG + Intergenic
931614617 2:64143933-64143955 CTGCGCGCCCCCGCTGCGGCGGG - Intronic
931671753 2:64653976-64653998 CCGCCCGACCCCGCCCCCGCCGG + Intronic
931711000 2:64989165-64989187 GCCCGCGCCCCCGCGGCCTCGGG + Intronic
932567686 2:72919977-72919999 CCGCGGGCCGCCGCGGCCGAGGG + Intronic
932607674 2:73175833-73175855 GCGCCCGCCCCCGCCGCCGCGGG - Intergenic
932773194 2:74513207-74513229 CCACCCGCCACCGCCACCGCAGG + Intergenic
934251712 2:90360565-90360587 CTTTTCGCCCCCGCCGCCGCAGG - Intergenic
934257723 2:91442378-91442400 CTTTTCGCCCCCGCCGCCGCAGG + Intergenic
934257790 2:91442619-91442641 CTTCCTGCCCCCGCCGCCGCGGG + Intergenic
934566986 2:95346618-95346640 CCCCGCGCCCCGGCGCCCGCGGG + Intronic
935622831 2:105144111-105144133 CTGCGCGGCCGCGGCGCCGCCGG - Intergenic
936104527 2:109613745-109613767 CCGCGCTCCCCGGCCCCCGCGGG - Intronic
936278668 2:111120582-111120604 GCGCACGCCGCGGCCGCCGCCGG + Intronic
936433181 2:112482008-112482030 CCCTGCGCCGCCGCCGCCCCCGG + Intergenic
937203848 2:120223434-120223456 CCACCCGGCCCCGCCCCCGCAGG - Intergenic
938296598 2:130182803-130182825 CCGCCCGCCACCCCCGCCACTGG - Intronic
938338917 2:130522796-130522818 CCGCGCGGCCGCGCTGCTGCAGG + Exonic
938350921 2:130597954-130597976 CCGCGCGGCCGCGCTGCTGCAGG - Exonic
938460150 2:131491826-131491848 CCGCCCGCCACCCCCGCCACTGG + Intronic
939153808 2:138501762-138501784 CCGCGCGCACGCGCCCTCGCGGG + Intergenic
939432658 2:142130785-142130807 CCTGCCGCCGCCGCCGCCGCCGG - Exonic
940918899 2:159286582-159286604 CCGCGCGCCCCCGCTCCTGCAGG - Exonic
941029242 2:160493183-160493205 CGGCGAACCCCCGCCACCGCCGG - Intronic
941095869 2:161238943-161238965 CCGCGCGTCCTTCCCGCCGCTGG + Intergenic
941119112 2:161507856-161507878 CCCGCCGCCGCCGCCGCCGCGGG + Intronic
941367081 2:164621737-164621759 CTGGGCGGCCCCGGCGCCGCTGG + Exonic
941951308 2:171160201-171160223 CCCCCCGCCCCCCCCGCCCCGGG - Intronic
942240810 2:173963724-173963746 CGGCCCGCCCCCGCCGAGGCCGG - Intronic
942240824 2:173963765-173963787 GCCGGGGCCCCCGCCGCCGCCGG - Exonic
943725331 2:191246094-191246116 CCCTCCTCCCCCGCCGCCGCCGG - Intronic
944433212 2:199659340-199659362 GCGGGCCCCCCAGCCGCCGCCGG + Intergenic
946227027 2:218269658-218269680 CCGCGCGCCCCCGCGGACCCCGG - Intronic
946306572 2:218859889-218859911 ATGGGCCCCCCCGCCGCCGCCGG + Exonic
946412638 2:219522737-219522759 CCGCCCGCCCCCGCGGCGGCCGG - Intronic
946966421 2:225042201-225042223 CCGCGCGCCCCAGGCGCCCGGGG - Intronic
947418480 2:229921700-229921722 TTCCGCGGCCCCGCCGCCGCCGG + Intronic
947669141 2:231925784-231925806 CCCCACGCGCCCGCCGGCGCGGG + Intronic
947765317 2:232633910-232633932 CTGCGCGGCCCCGGCGCTGCAGG + Exonic
948140858 2:235670828-235670850 GCGCGCGCTCCAGCCGCTGCAGG - Intronic
948467433 2:238159062-238159084 CTGCTGGCCGCCGCCGCCGCGGG + Exonic
948645225 2:239400435-239400457 CCCCGCGCCCCCGCCCCGGCGGG + Exonic
948801583 2:240435737-240435759 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
948854755 2:240724927-240724949 CCCCCCCCCCCCCCCGCCGCCGG - Intronic
948945699 2:241217976-241217998 CTGCGCGCCCCCGCTGCCCCCGG - Intronic
948953991 2:241272897-241272919 GCGCCCGCCCGCCCCGCCGCTGG + Intronic
1168757151 20:325699-325721 CGGCGCGCCCCCGCCGCCTCCGG - Exonic
1168757256 20:325988-326010 TCGCGCGCCCCCTCCTCGGCCGG - Exonic
1169164123 20:3407693-3407715 GCCCCCGCCCCCGCCCCCGCCGG - Intergenic
1169220593 20:3820253-3820275 CGGCGCCCCCTCGCGGCCGCCGG + Intergenic
1170999273 20:21396833-21396855 CCGCGCGCCCGCTCGGCCCCAGG + Intronic
1171473546 20:25390549-25390571 CAGCGCGGCTCAGCCGCCGCCGG + Exonic
1172618729 20:36306485-36306507 CCGGGCGCCTCGGCCGCCTCCGG - Exonic
1172794558 20:37527854-37527876 CAGCTCGCCACCGACGCCGCAGG + Exonic
1173210724 20:41029362-41029384 CCGCGCGCGCTCGCCGCCGGAGG + Intronic
1173251603 20:41366696-41366718 CGCCGCGCCGCCCCCGCCGCTGG + Exonic
1174204338 20:48828018-48828040 CCGCGCGCTGCCTCCGCCCCCGG - Intergenic
1174204477 20:48828486-48828508 ACGCGCGCCTCCGCGGCCCCGGG + Intergenic
1175338099 20:58209656-58209678 CCCCCCGCCCCCGCCCCCACCGG + Intergenic
1175399664 20:58693130-58693152 CGCCGCACCCCCGCCGCCGCCGG + Intronic
1175888022 20:62303170-62303192 CCGCCCGGCCCGGCCCCCGCAGG - Intronic
1175926776 20:62475195-62475217 CCCCGCGCTGCCGCCGCTGCCGG + Exonic
1176061578 20:63175067-63175089 CCTCCCGCTCCCGCCCCCGCCGG + Intergenic
1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG + Intergenic
1176547887 21:8209265-8209287 GCGCGCGCCCCGGCGCCCGCGGG - Intergenic
1176549076 21:8213727-8213749 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1176549293 21:8214485-8214507 CCGCCCACCCCCGCACCCGCCGG - Intergenic
1176556970 21:8257947-8257969 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1176557186 21:8258708-8258730 CCGCCCACCCCCGCACCCGCCGG - Intergenic
1176568008 21:8396765-8396787 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1176568225 21:8397523-8397545 CCGCCCACCCCCGCACCCGCCGG - Intergenic
1176575912 21:8440984-8441006 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1176576128 21:8441743-8441765 CCGCCCACCCCCGCACCCGCCGG - Intergenic
1177011044 21:15730327-15730349 CCTCGCGCCTCCGCCGGCCCTGG - Exonic
1177187968 21:17819108-17819130 CCGCGCGCCCCCAACGCCGAAGG - Intronic
1178513836 21:33229904-33229926 CGCCGCGCCGCCGCCGGCGCGGG - Intronic
1179511884 21:41878980-41879002 CCGCCGGGTCCCGCCGCCGCGGG - Exonic
1179605659 21:42513872-42513894 CAGCCCGGCCCGGCCGCCGCGGG - Intronic
1179784054 21:43719692-43719714 CCGCCCGCCCCCGCGGCAGTTGG - Intronic
1179874686 21:44261949-44261971 CCGCCCCTCCCCGCCCCCGCGGG - Exonic
1179968046 21:44818153-44818175 CTGCGCGCGCCCGACGCCCCGGG - Intronic
1180064234 21:45404916-45404938 TCGCCCGTCCCCGCCGCCCCCGG + Intergenic
1180093148 21:45542688-45542710 CCTCGGGCCCCCACCCCCGCCGG + Intronic
1180949525 22:19714870-19714892 AGGCGCGACCCCGCCCCCGCCGG + Intronic
1180960677 22:19761024-19761046 CCGTGCGCCGCCGCCGCCCCCGG + Exonic
1181230131 22:21417245-21417267 CGGCCCGGCCCCGCCCCCGCAGG + Intergenic
1181248518 22:21517621-21517643 CGGCCCGGCCCCGCCCCCGCAGG - Intergenic
1181514382 22:23402714-23402736 CCTCGCGCCCGCGCTCCCGCCGG - Intergenic
1181632022 22:24156378-24156400 CCGCGCGCCGCCGCCCAAGCCGG - Intronic
1182355372 22:29720334-29720356 CCGCCCGCTCCAGCCGCCCCCGG + Exonic
1182903886 22:33920554-33920576 CCGCCCGCCCGCGGCTCCGCGGG + Intronic
1183368594 22:37419915-37419937 CCGCCAGCCCCCGCCCCTGCCGG + Intronic
1183504695 22:38202510-38202532 CACAGCGCCCCCGCCCCCGCCGG - Intronic
1184101463 22:42343643-42343665 CCGCGCGCCCCGGCCGGCCCGGG + Intergenic
1184698019 22:46150540-46150562 CCGCCCGCTGCCCCCGCCGCGGG - Intronic
1184711365 22:46251040-46251062 TCCCTCGCCCCAGCCGCCGCGGG + Intergenic
1184759486 22:46536742-46536764 CTGCGCGGCCGCGCAGCCGCCGG + Exonic
1184767074 22:46577504-46577526 CCGCGGGCACCTGCGGCCGCAGG + Intronic
1185037876 22:48489291-48489313 AGGCGCGCGCCCGCCACCGCTGG - Intergenic
1185229543 22:49672277-49672299 CCCCCCGCCCCCACCCCCGCTGG - Intergenic
1185375687 22:50481767-50481789 CCGCGAGCCACCCCCTCCGCCGG - Exonic
1203253963 22_KI270733v1_random:130042-130064 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1203254178 22_KI270733v1_random:130801-130823 CCGCCCACCCCCGCACCCGCCGG - Intergenic
1203262019 22_KI270733v1_random:175121-175143 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1203262234 22_KI270733v1_random:175880-175902 CCGCCCACCCCCGCACCCGCCGG - Intergenic
949987522 3:9552697-9552719 CCGCCAGCCGCCGCCGCCGCCGG - Exonic
950729893 3:14947939-14947961 AGGCCCGCCCCCTCCGCCGCCGG - Intronic
951080301 3:18444721-18444743 CCTGCCGCCGCCGCCGCCGCCGG + Intronic
951906951 3:27715359-27715381 CGCTGCGCACCCGCCGCCGCCGG - Intergenic
952867192 3:37862004-37862026 GCTCCCGCCGCCGCCGCCGCTGG - Intronic
953912190 3:46898831-46898853 CCGCCTGCCACCGCCGCTGCCGG + Exonic
954076867 3:48188032-48188054 CCGCGCGCCACCGGCGCCCGCGG + Exonic
954110229 3:48429409-48429431 CCGCGCGGCGCTGCCACCGCCGG + Exonic
954392197 3:50273698-50273720 CCGGGAGCCCCCGCCGCAGCGGG + Intronic
954693790 3:52409940-52409962 CCGGGAGCCCCCACCGCCCCCGG + Exonic
956129111 3:66038120-66038142 CCTCGGGCCCTCGCCGCCGCCGG + Exonic
957072871 3:75579932-75579954 CCCCGCGCCCCCGGCACCCCCGG + Intergenic
958638542 3:96776880-96776902 CCGCGGGCCGCGCCCGCCGCCGG + Intergenic
958718935 3:97821903-97821925 CCGGGCGCAGCCGCCACCGCTGG - Intergenic
961012933 3:123448179-123448201 CCGCGCCCCGCCGCTGCCGGCGG + Exonic
961377251 3:126475396-126475418 CCGCCCGGCCCCGCAACCGCGGG - Exonic
961665014 3:128489251-128489273 CCGGGCGCCCCCGGAGCCGAGGG - Intronic
961674282 3:128555418-128555440 CCGGGTGCCCCGGCCTCCGCCGG - Intergenic
962222299 3:133573990-133574012 CCGCGGGCCGCGCCCGCCGCCGG + Exonic
962738864 3:138348665-138348687 CCGCCGGGCCCCGCGGCCGCCGG - Intronic
963733072 3:148991429-148991451 CCGCGGGCCACCGCCCCTGCCGG + Exonic
964201452 3:154122397-154122419 GCCTGCGCCGCCGCCGCCGCCGG + Exonic
964227907 3:154428765-154428787 CCGGGTGCGCCCGCTGCCGCTGG - Exonic
964482807 3:157159644-157159666 CGGCACGCCCCGGCCGCGGCTGG + Intronic
966181864 3:177196473-177196495 CCGCGCGCCCCTCCCCCGGCCGG + Exonic
966182291 3:177197849-177197871 CGCCCCGCCCCCACCGCCGCGGG + Intergenic
967859741 3:194141715-194141737 CCGCGCGGCCCCGCCGGGCCTGG + Intergenic
968148239 3:196317855-196317877 CCGGGCGCCCCTCCCGCTGCAGG - Intronic
968161641 3:196432028-196432050 CCGTCCGCCCCCGCCGGCCCGGG - Intronic
968225434 3:196969518-196969540 CCGCGCGCCGTCGCCGACCCCGG - Intergenic
968583612 4:1406012-1406034 CGCCGCGCCCTCGCCGGCGCCGG - Exonic
968620779 4:1602663-1602685 CCGCGCGCCCCCTCCCCGCCAGG + Intergenic
968673037 4:1862610-1862632 CCCCGCGACCCCGCCCCAGCCGG - Intergenic
968815264 4:2818480-2818502 CCGCGAGCCCCGGGCGCTGCTGG + Intronic
968835922 4:2964046-2964068 CCTGGCGCCGCCGCCGCCGGCGG - Exonic
968850469 4:3074528-3074550 CAGCCCGCCCCTGCCCCCGCAGG - Intergenic
968850485 4:3074607-3074629 CGGCGTGGCCCCGCCTCCGCCGG + Intergenic
968850493 4:3074627-3074649 CGGCGCGGCCCCGCCTCCGCCGG + Intergenic
969016479 4:4107234-4107256 CCCCGCGCCCCCGGCACCCCCGG + Intergenic
969360047 4:6657741-6657763 CCACGCGCCCTCGCCTGCGCGGG - Intergenic
969716843 4:8871898-8871920 CCGCGACCCCCCGCCCCTGCTGG - Intergenic
969787927 4:9473700-9473722 CCGGGCGCCCCCCGCGCTGCGGG + Intergenic
970001900 4:11372840-11372862 CCCCGGGCCGCCGCCGCCACAGG + Intergenic
970824370 4:20254035-20254057 CCGCGCACCCCTGCCTCCACTGG + Intronic
970967872 4:21948843-21948865 CCGCGCGCCCCCGCCGCCAAGGG - Intergenic
971327432 4:25655739-25655761 CCGCCTGCCGCAGCCGCCGCCGG - Intronic
972311934 4:37890660-37890682 CCCCGCGCCCCCGGCTCCCCAGG + Intergenic
974069372 4:57110213-57110235 CTGCCCGCCCCTGCCCCCGCTGG - Exonic
974892307 4:67896823-67896845 CCGGCCGGCCCTGCCGCCGCTGG - Intergenic
975342567 4:73258559-73258581 CCGCCGACCTCCGCCGCCGCGGG + Exonic
976053069 4:81031165-81031187 CCGTGCGCCCTCGCCCCAGCTGG + Exonic
978126836 4:105146176-105146198 CCGCGCGCACCCACCTCCTCCGG - Intronic
978777206 4:112516022-112516044 CGGGCCGCCGCCGCCGCCGCCGG - Exonic
979674683 4:123398349-123398371 TCCCCCGCCCCCGCCGCCACCGG - Intronic
980930279 4:139177435-139177457 CCGCGGGGCCCCGCCGCCCTCGG + Intergenic
981429822 4:144645971-144645993 CCGCCCCTCCCCGCCGCAGCAGG + Intergenic
981516779 4:145618973-145618995 CCGGGGGTCCCGGCCGCCGCAGG + Exonic
981782880 4:148445562-148445584 CCGCGCGCCCCCGCGTCTCCTGG + Intergenic
982042368 4:151409034-151409056 GGCCCCGCCCCCGCCGCCGCCGG - Intergenic
983077518 4:163343976-163343998 CGGGGCGCCCCGGCCGCTGCAGG - Intronic
984972559 4:185203971-185203993 CCGCGCGCCCGCGCTTCCGGAGG + Exonic
985068446 4:186144978-186145000 TCACGCGCCCCCGCGGCCCCGGG - Exonic
986330774 5:6714488-6714510 CCGCGCGGCCCCGCGCCCGCCGG + Intergenic
987050407 5:14143573-14143595 CCGCCGCCCCCCGCCGCCCCGGG + Intergenic
987132417 5:14871873-14871895 CAGCCCGCCCCCGGGGCCGCTGG - Intergenic
988437579 5:31194033-31194055 CCGCGCGCCCGCCCCGACCCGGG - Intronic
988482106 5:31639451-31639473 CCGCGCGTCCCGGCTGCAGCGGG - Intronic
992067459 5:73120712-73120734 CCGCGCGCCTGCGCCGGCGGCGG + Intronic
992124376 5:73626054-73626076 CCGCGCCTCCCCGCTGCCACTGG - Intergenic
992487591 5:77210878-77210900 CCGCCCGCGCCCGCGGCCGCCGG - Exonic
993116145 5:83722201-83722223 CCGCGCCGCCCCGCCGGGGCCGG - Intergenic
994083323 5:95731545-95731567 TCGCGCGCCTCCACCGCGGCGGG - Exonic
995106375 5:108381468-108381490 CCCGGCGCGCCCGCCCCCGCCGG - Exonic
995462576 5:112419326-112419348 CCCCGCGCCCCCGCCTTCGGAGG - Intergenic
996082258 5:119268946-119268968 CAGCGCGCCTCTCCCGCCGCTGG + Intronic
996785060 5:127229349-127229371 CCGCCCGGGCCCGCCGCAGCCGG + Intergenic
997013338 5:129904387-129904409 CCTCCCGCTCCCCCCGCCGCCGG - Intergenic
997521377 5:134526331-134526353 CCGCGCCCCCTCGCCGGCCCGGG - Intronic
997965480 5:138352880-138352902 CCGCTCGCCGCTGCCGCCGCGGG - Exonic
999375123 5:151081171-151081193 CCGCGGGCCCCCGGAACCGCAGG - Intronic
999462910 5:151772166-151772188 CCGCGCGCGCCTGCGGCCGTTGG - Intronic
1000305060 5:159987279-159987301 CTGGGCGCCCCCGCCGCAGGAGG - Intergenic
1000319030 5:160119163-160119185 CCCGCCGCCACCGCCGCCGCCGG - Exonic
1001035127 5:168291932-168291954 CCGCCCGCTCCTCCCGCCGCCGG - Intronic
1001070222 5:168579348-168579370 CCGCGCGGCCCAGCCACCTCCGG - Exonic
1001401923 5:171451049-171451071 CCGCCCCCCCACCCCGCCGCCGG + Intronic
1001440304 5:171737762-171737784 CAGCACGCCACCGCTGCCGCTGG + Intergenic
1002352050 5:178590156-178590178 CCCCGCGTCGCCGCCGCCACCGG + Exonic
1003175901 6:3751981-3752003 CCTCGCGGCCCCGGAGCCGCAGG + Exonic
1003603808 6:7542007-7542029 GCTGGTGCCCCCGCCGCCGCTGG - Exonic
1003942674 6:11044372-11044394 CCGCGCCTCCCCGCCCCCTCGGG + Intergenic
1004044389 6:12011620-12011642 CCGCCCGGCCGAGCCGCCGCAGG - Intronic
1004228944 6:13814068-13814090 CCGGGCGTCGCCGCTGCCGCCGG - Exonic
1004690328 6:17987653-17987675 CCGCGCGCCCGCCCCTCCCCGGG - Intergenic
1006472660 6:34237335-34237357 CCCTCCGCCGCCGCCGCCGCGGG - Intronic
1006860904 6:37170892-37170914 CGGCGCGCCCTCCCCACCGCGGG - Intronic
1007347133 6:41239702-41239724 CCGCTCGCCTGCGCCCCCGCGGG - Intergenic
1007431516 6:41779904-41779926 CCGCCCCGCCCCGCGGCCGCGGG + Intronic
1007431574 6:41780109-41780131 CCGCGCCCCGCCTCCGCCGCAGG - Intronic
1007644437 6:43369468-43369490 CTGCGCGCCGCCTCAGCCGCGGG + Intronic
1007785107 6:44275381-44275403 CCGCCTGCCCCCCGCGCCGCAGG + Exonic
1007800505 6:44388145-44388167 CCCCGCCCCCCCGCCCCCCCCGG + Intronic
1008276683 6:49550937-49550959 CGGCTCGCCCCTGCCGTCGCGGG - Exonic
1010001514 6:70954905-70954927 CCGCCCCCCCCCGCCGCCCCCGG - Intronic
1011128737 6:84033708-84033730 CCCCGCGCCGCCTCCGCTGCGGG + Intergenic
1011459688 6:87590104-87590126 CCGCGCGCCCTCGCGGCTGCAGG - Intronic
1012211278 6:96521716-96521738 CCGCCCGCCCCCCGCGCCTCGGG + Intronic
1013155803 6:107490254-107490276 GCTCCCGCCGCCGCCGCCGCCGG - Exonic
1013170820 6:107635023-107635045 ACGCGCGGCGCCGCCGCCGAGGG + Exonic
1013619281 6:111872872-111872894 GCGCACGCCGCCCCCGCCGCAGG - Intronic
1013803296 6:113970821-113970843 CCGCGCGCCCACCCCGACACCGG + Intronic
1014233979 6:118935031-118935053 CCGCGCGTCCCCGCGGCCGGTGG - Exonic
1014272574 6:119349938-119349960 CCCCGCGACCTCCCCGCCGCCGG - Intergenic
1015328508 6:131951077-131951099 CCGGGAGCCCCCGCTGCGGCCGG - Intronic
1016328180 6:142926828-142926850 CCGCGCCCGGCGGCCGCCGCAGG - Intronic
1016330517 6:142947527-142947549 CCGAGCGCCCAGGACGCCGCGGG + Intergenic
1016378685 6:143450684-143450706 CCGCGCTCCTCCTCTGCCGCGGG - Intergenic
1016863962 6:148747769-148747791 CCGCGCGCCGCCGCCGCCCCGGG + Intronic
1017446346 6:154510334-154510356 CCTCCTTCCCCCGCCGCCGCCGG + Exonic
1017497637 6:154995561-154995583 CCGCGCGCCGCCCCGCCCGCAGG - Intronic
1017672044 6:156777942-156777964 GCGGGCGCCGCGGCCGCCGCCGG + Exonic
1017672353 6:156779074-156779096 GCTCGCGGCCCCGCCGCCCCCGG - Exonic
1017738021 6:157381292-157381314 CCGCGAGCCGCCGCCGCCCTCGG + Exonic
1017738130 6:157381659-157381681 CCGCTCGGCCCCGCAGCCCCCGG - Exonic
1017793634 6:157823068-157823090 CCGCGCCGCGCCGCCGCCCCGGG - Intronic
1018876777 6:167827575-167827597 CGCCGCGCCCCCCGCGCCGCCGG - Intronic
1019279673 7:193410-193432 CCGGCCGCCTCCTCCGCCGCCGG + Exonic
1019343756 7:519998-520020 CCGGGCGCCGCCGCCGCGGCAGG + Intronic
1019473381 7:1232931-1232953 CCGCCCGCGCCTCCCGCCGCTGG + Exonic
1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG + Intergenic
1019577680 7:1745421-1745443 CCCGCCGCCCCCGCCTCCGCCGG + Exonic
1019711348 7:2519554-2519576 CCCCGCACCCCCCCCGCCCCGGG - Intronic
1020204602 7:6105090-6105112 CCGCTCGCCTGGGCCGCCGCTGG + Intronic
1020274460 7:6615907-6615929 CCTCCCGCCCCAGCCCCCGCCGG + Exonic
1020418205 7:7969441-7969463 CCGCCCGCCGTCGCCGCCGCCGG + Exonic
1022528625 7:31053423-31053445 CCGCCCCCCGCAGCCGCCGCAGG - Intronic
1023773689 7:43583336-43583358 CCGGCCGCCGCCGCCGCCCCAGG + Exonic
1023810326 7:43906520-43906542 CCCTGCGCCCCCGCGGCTGCCGG - Intronic
1024216657 7:47254383-47254405 CCGCTCACCCCCTCCCCCGCAGG + Intergenic
1025320110 7:58086925-58086947 CTTTTCGCCCCCGCCGCCGCAGG + Intergenic
1026004694 7:66591769-66591791 CCCGGCGCCCCTGCCGCGGCCGG + Intergenic
1026025597 7:66741253-66741275 CCCCGCGCCCCTGCCGCGGCCGG - Intronic
1026360877 7:69599757-69599779 CCGGCCAGCCCCGCCGCCGCCGG - Exonic
1027151894 7:75739091-75739113 CCGCCCGCCCCCGCCCCTTCAGG + Intergenic
1028098047 7:86786688-86786710 CTGCGCGCCCCAGCCGTCGCTGG - Exonic
1028922355 7:96322101-96322123 CCACGCCCTCCCGCCGGCGCGGG + Exonic
1029461069 7:100694133-100694155 CCGCGCGCCGCCCACGCCCCGGG - Intergenic
1029537334 7:101164165-101164187 GCGCGCGCCCCTGCCGCCCCCGG - Exonic
1029640339 7:101816192-101816214 CCCCTCCTCCCCGCCGCCGCGGG - Intronic
1029672782 7:102045436-102045458 CCGCGCGCCCCCTCCGATGTGGG + Intronic
1031025202 7:116672259-116672281 CAACGCGCCCGGGCCGCCGCGGG + Intergenic
1033899336 7:146116415-146116437 GCGAGCGCTCCCTCCGCCGCCGG - Exonic
1034192709 7:149224046-149224068 CCCATCGCCCCCGCCGCCCCCGG - Exonic
1034344817 7:150379556-150379578 CCGCGCGCCCCCCGAGCCCCGGG + Intronic
1034426936 7:151018899-151018921 CCGCGCGCCCCCAGCGCGCCAGG + Exonic
1034455501 7:151167815-151167837 CCGCCCGCCGCCGCCGCGCCCGG + Intronic
1034469854 7:151249230-151249252 CCGGGCACACCCACCGCCGCCGG - Intronic
1034963064 7:155374283-155374305 CCGCCCGGCCCAGCCCCCGCCGG - Intergenic
1035751814 8:2001853-2001875 CAGCGCGCCACCGACGCCGTGGG + Exonic
1036900309 8:12665232-12665254 CCCCGCGCCCCCGGCACCCCCGG + Intergenic
1036950342 8:13133557-13133579 CCCCGCGCCTCCTCCGCCGAAGG + Intronic
1037305152 8:17497032-17497054 CCGCGCCCCGCCCCCGCCCCGGG + Intergenic
1037450666 8:19013602-19013624 CCGCGCGCCGAAACCGCCGCCGG + Exonic
1037819912 8:22130584-22130606 TAGAGCGCCCCCGCCGCCCCGGG - Exonic
1037826794 8:22164841-22164863 CCGAGCCCCCGCCCCGCCGCGGG - Exonic
1039903129 8:41767187-41767209 GCGCGCGCACCCGCACCCGCCGG + Intronic
1039903168 8:41767293-41767315 CCCCGCGCCCCGGCCCCGGCCGG + Intronic
1039936583 8:42051601-42051623 CCCCGCGCCCCCGATCCCGCCGG - Intronic
1039981027 8:42410206-42410228 CCGCCCGCCCGTGCAGCCGCTGG - Intergenic
1041502393 8:58553266-58553288 CCGCTCGCCGCCGCCGCCTCCGG - Exonic
1041689900 8:60678705-60678727 CCGCGCGCACCCGAAGCCGCGGG - Intergenic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1042591775 8:70403662-70403684 CCGCCCGCCCTCGCGGCCCCGGG + Intronic
1044569344 8:93700346-93700368 CCGCGCGTCCCTGCCGGCGAAGG - Intronic
1044999771 8:97869275-97869297 CCGCGCTCACCTGCAGCCGCCGG - Exonic
1045516294 8:102863626-102863648 CCCGCCGCCGCCGCCGCCGCCGG + Intronic
1045571314 8:103371557-103371579 CCGCGCTCCGAGGCCGCCGCAGG - Exonic
1045673923 8:104588423-104588445 GAGCTCGCCCCCGCCGCTGCCGG - Intronic
1048833325 8:138496866-138496888 CTGCCCTCGCCCGCCGCCGCCGG + Intergenic
1049082908 8:140457180-140457202 CCGCGCGTCCCAGACCCCGCGGG + Intronic
1049212236 8:141392102-141392124 CCGCGCGCCCCCGCCCCGAGCGG - Intronic
1049585301 8:143430161-143430183 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1049585407 8:143430505-143430527 CGGCGCCCCCCCGCCCCCGCCGG - Intergenic
1049585461 8:143430689-143430711 CCGCGCCCCACCCGCGCCGCCGG + Intergenic
1049643626 8:143726591-143726613 CCGCTCGGCCCCTCCTCCGCGGG + Exonic
1049708251 8:144052519-144052541 CCGCCCACCACCGCCGCCTCGGG + Exonic
1049719265 8:144108128-144108150 CCCCGCGCGCCCGCGCCCGCCGG + Exonic
1049769856 8:144374717-144374739 CCCCGCCCGCCCGCCGCCTCAGG - Intronic
1049769884 8:144374835-144374857 CCCCGCTCCCACGTCGCCGCCGG + Intronic
1049790992 8:144472685-144472707 CCGCGCGCTCCAGGCACCGCAGG + Exonic
1049843200 8:144787244-144787266 CCCCGCGCGCCCGCCCCCGCCGG + Intronic
1050151283 9:2621788-2621810 CCCCGCTCTCCGGCCGCCGCCGG + Intergenic
1052048316 9:23820736-23820758 CCGTGCACCCCGGCCGCCGCTGG + Intronic
1052362213 9:27573443-27573465 GCCTGCGCCTCCGCCGCCGCGGG + Intronic
1052494719 9:29212448-29212470 TCGCGCGCCCCCGAGTCCGCAGG + Intergenic
1053066428 9:35072372-35072394 CCGCGGGCCGCCACAGCCGCCGG - Exonic
1053114528 9:35489822-35489844 CGGCCCGCGCCCGCCCCCGCGGG - Intergenic
1053229964 9:36400406-36400428 CCGCGCCTCCTCGCCACCGCGGG + Intronic
1053410749 9:37914705-37914727 ACCCCCGCCCCCGCCTCCGCAGG - Intronic
1053943553 9:43280047-43280069 CCCCCCCCCCCCGCCGCCTCGGG - Intergenic
1055091117 9:72365283-72365305 CCCGCCGCCGCCGCCGCCGCCGG - Intergenic
1055321671 9:75088488-75088510 CCGCCCCGCCCCGCGGCCGCCGG - Intergenic
1056470727 9:86902799-86902821 CCGCGCGCCCCCGCAGAGGCCGG - Intergenic
1056922340 9:90801822-90801844 CCTCGCTCTCCAGCCGCCGCCGG - Exonic
1056992268 9:91423493-91423515 CCGCGCGCACTCGCCGCCGCTGG + Intronic
1057347012 9:94259984-94260006 CCGCGCCCCACCCCAGCCGCCGG + Intronic
1057361098 9:94374548-94374570 CAGCCCGCCCCTGACGCCGCCGG + Exonic
1057662260 9:97013604-97013626 CAGCCCGCCCCTGACGCCGCCGG - Intergenic
1059145548 9:111896680-111896702 CCGCGCGCCCGCTGCGGCGCCGG - Intergenic
1059176733 9:112175143-112175165 CGGCGCTCCCGCGGCGCCGCGGG + Exonic
1060087280 9:120714212-120714234 CCCCGCGGCCCCGCCGCCACCGG + Exonic
1060514666 9:124258188-124258210 GCGCGCGCCCACGGCTCCGCGGG + Intronic
1061128199 9:128689724-128689746 GCGCGCGCCCCGGGCCCCGCCGG - Intronic
1061453513 9:130681668-130681690 GAGCGCGCCCGCGCCCCCGCCGG + Exonic
1061472174 9:130835345-130835367 GCGCGCCCCCCCGGCGCCCCCGG - Intronic
1061975711 9:134067355-134067377 CCGCGCGCCGCGGCCGGGGCGGG - Intronic
1062162418 9:135087686-135087708 CCGGGCTCCTCCGCCGCCACCGG - Intronic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1062435793 9:136546092-136546114 CCGCCCGGCCCCACCCCCGCCGG + Intergenic
1062472530 9:136712736-136712758 CGGTGCGCGCCCGCCGCCCCCGG + Intronic
1062596509 9:137302178-137302200 CCGCGCGGCGCCGCCGTCCCCGG - Exonic
1062630773 9:137462142-137462164 CCGCCCGCCTCCGCCGCCGCGGG + Intronic
1203470363 Un_GL000220v1:113186-113208 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1203470579 Un_GL000220v1:113945-113967 CCGCCCACCCCCGCACCCGCCGG - Intergenic
1203478184 Un_GL000220v1:157158-157180 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1203478400 Un_GL000220v1:157917-157939 CCGCCCACCCCCGCACCCGCCGG - Intergenic
1185623195 X:1465853-1465875 CCGCGCGCCTCCGCTGCTCCCGG + Exonic
1185778813 X:2828862-2828884 CCGCCAGCCCCCGCGGGCGCGGG - Exonic
1187915549 X:24149802-24149824 CCGGGTGCCGCCGCGGCCGCGGG + Intronic
1188003526 X:25002647-25002669 CGCCACGCCGCCGCCGCCGCCGG - Intergenic
1188242667 X:27809515-27809537 GCCCGCCCCCCCCCCGCCGCCGG + Intronic
1189325644 X:40109279-40109301 CCGCGCGCTCCTGGCGCGGCTGG + Intronic
1189335584 X:40168924-40168946 CCGCCCGCCCTGGCCGGCGCAGG + Intronic
1189446220 X:41084613-41084635 CCTCGCGCCCCCGCAGCCAGTGG + Intergenic
1189821326 X:44872779-44872801 CCGCTCGCGCCCGCCGCGGGCGG + Intergenic
1190108274 X:47574026-47574048 CCACCCGCCACCGCCGCTGCAGG - Exonic
1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG + Intronic
1197415269 X:126165982-126166004 CCACGCGCCGCCACCGCCGCCGG - Intergenic
1197754430 X:129984095-129984117 CCGCCCGCCCGCCCCGCCGCCGG - Intronic
1198767163 X:140091576-140091598 CCGCGCGCCCGCCCGCCCGCAGG + Intergenic
1199736866 X:150693540-150693562 CCCGCCGCCGCCGCCGCCGCCGG - Exonic
1200098203 X:153673902-153673924 CAGCGCGGCCGCGGCGCCGCAGG + Intronic
1200100693 X:153688103-153688125 CCGCGGGCCCCGGCCGGGGCGGG + Exonic
1200128909 X:153830643-153830665 CCGCGCGCCTCCCCGCCCGCGGG + Intergenic
1200173702 X:154097452-154097474 CCTCCCCCTCCCGCCGCCGCCGG - Intronic
1200306069 X:155027084-155027106 GCGCGCGCGGCCGGCGCCGCGGG + Intronic
1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG + Intronic