ID: 1041690274

View in Genome Browser
Species Human (GRCh38)
Location 8:60680045-60680067
Sequence TATTATGCAGCTGCCGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041690274_1041690280 30 Left 1041690274 8:60680045-60680067 CCGGCGGCGGCAGCTGCATAATA 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1041690280 8:60680098-60680120 CCCCCGCCCCCCAACCCGCCGGG No data
1041690274_1041690275 5 Left 1041690274 8:60680045-60680067 CCGGCGGCGGCAGCTGCATAATA 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1041690275 8:60680073-60680095 TTTAACCTTCCAACGCAACTCGG No data
1041690274_1041690278 29 Left 1041690274 8:60680045-60680067 CCGGCGGCGGCAGCTGCATAATA 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1041690278 8:60680097-60680119 TCCCCCGCCCCCCAACCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041690274 Original CRISPR TATTATGCAGCTGCCGCCGC CGG (reversed) Intronic
916725464 1:167518556-167518578 TATTCTGCAGCTACCTCCCCAGG + Intronic
1065925999 10:30434243-30434265 GCTTCTGCCGCTGCCGCCGCCGG + Exonic
1066370456 10:34814990-34815012 TTTCATGCCGCCGCCGCCGCGGG + Exonic
1066745030 10:38600348-38600370 CATTTTGCCCCTGCCGCCGCAGG + Intergenic
1071568920 10:86685933-86685955 TCTTAAGCAGCTGCTGCAGCAGG - Intronic
1075967144 10:126622757-126622779 TTTTATGCAGCTGCAGTCCCTGG + Intronic
1108730603 13:53231353-53231375 TATTATGCAGATACCCACGCAGG - Intergenic
1109413876 13:62009922-62009944 TATGATGCTGCTGCTGCTGCAGG - Intergenic
1113758631 13:112832321-112832343 GATTCTGCAGCTGCAGGCGCAGG + Intronic
1121509853 14:94504301-94504323 TATCATGCCGCTGCCTCCACAGG - Intronic
1122071533 14:99208430-99208452 TATTAAGCAGTTGCTGCCACTGG + Intronic
1125957227 15:43798960-43798982 TATTATGCAGCTGTGCCCGCGGG + Exonic
1126158241 15:45585248-45585270 TATTATGCAGATGAAGCCTCTGG + Intergenic
1139582757 16:67883129-67883151 TATCCTGCAGCTGCTGCAGCAGG + Exonic
1141481148 16:84307855-84307877 GATTATGCACCTGCTGCGGCTGG + Intronic
1144413635 17:15024552-15024574 TATCATGCAGCTGCTGCTGCAGG + Intergenic
1145966056 17:28918156-28918178 AATTAGGCAGCTGCCACAGCAGG - Intronic
1152357307 17:79813438-79813460 TTTTCTGCAGCTGCCGCGGCCGG + Intergenic
1164990039 19:32676368-32676390 TCTTTTGCAGCTCCTGCCGCAGG - Exonic
1202647200 1_KI270706v1_random:153202-153224 TCCTGTGCAGCTGCTGCCGCAGG + Intergenic
925098281 2:1224617-1224639 CATTCTGCAGATGCCGCCGAGGG - Intronic
925996197 2:9295527-9295549 CTTTATGTAGCTGACGCCGCAGG + Intronic
938548035 2:132352921-132352943 TCCTGTGCAGCCGCCGCCGCCGG - Intergenic
1171514531 20:25718953-25718975 TATTCTGCAGCCACCGCTGCTGG - Intergenic
1171876904 20:30585693-30585715 TCCTGTGCAGCCGCCGCCGCCGG - Intergenic
1174500806 20:50982486-50982508 AATGATGCAGCTGACGCCTCCGG - Intergenic
1175635480 20:60579270-60579292 TATTATGCAGATGAAGCCTCTGG + Intergenic
1176604668 21:8819572-8819594 TCTTGTGCAGCTGCTGCCGCAGG - Intergenic
1180346958 22:11711177-11711199 TCCTGTGCAGCTGCTGCCGCAGG - Intergenic
949121827 3:394361-394383 TATTATGAAGCTGGAGCAGCTGG + Intronic
953704723 3:45222321-45222343 TAATATCCAGCTGCTGCCGAAGG - Intergenic
972543197 4:40056885-40056907 TAGCAAGCAGCTGCGGCCGCGGG - Exonic
973373457 4:49271365-49271387 TCCTGTGCAGCTGCTGCCGCAGG + Intergenic
973387555 4:49523843-49523865 TCCTGTGCAGCTGCTGCCGCAGG - Intergenic
978663113 4:111152338-111152360 TATTCTGCAGCCACCGCTGCTGG - Intergenic
985972089 5:3386369-3386391 TAATATGCAGCTGCTGCTGGGGG + Intergenic
993865684 5:93192040-93192062 TATTATGCAGCTGCTTTAGCAGG - Intergenic
1001874730 5:175189860-175189882 AATTATGAAGCTGCAGCAGCTGG - Intergenic
1016245040 6:141970371-141970393 TGTTATGCAGCCACCGCTGCTGG + Intergenic
1024554517 7:50592050-50592072 GATTATGCAGCATCCACCGCTGG + Exonic
1035053389 7:156017633-156017655 TCCTCTGCAGCTGCCGGCGCTGG - Intergenic
1037238962 8:16755515-16755537 TGTTATGCAGCAGCAGCTGCCGG + Intergenic
1041690274 8:60680045-60680067 TATTATGCAGCTGCCGCCGCCGG - Intronic
1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG + Exonic
1044847234 8:96393762-96393784 TAGTATGCAGCTGAGTCCGCAGG + Intergenic
1045044074 8:98257727-98257749 TATTATGCAGATGAAGCCTCTGG - Intronic
1054258374 9:62838119-62838141 TCCTGTGCAGCCGCCGCCGCCGG + Intergenic
1054333395 9:63781922-63781944 TCCTGTGCAGCCGCCGCCGCCGG - Intergenic
1057719396 9:97519835-97519857 TATTATGAGGCTGTCGCTGCTGG - Intronic
1202800401 9_KI270719v1_random:170257-170279 TCCTGTGCAGCCGCCGCCGCCGG - Intergenic
1185464539 X:346631-346653 GTTTCTGCAGCGGCCGCCGCGGG - Intronic
1201153322 Y:11107231-11107253 TCCTGTGCAGCTGCTGCCGCAGG - Intergenic