ID: 1041690296

View in Genome Browser
Species Human (GRCh38)
Location 8:60680115-60680137
Sequence GCCGGGGGTCAGCGCCGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041690285_1041690296 -9 Left 1041690285 8:60680101-60680123 CCGCCCCCCAACCCGCCGGGGGT 0: 1
1: 0
2: 1
3: 21
4: 243
Right 1041690296 8:60680115-60680137 GCCGGGGGTCAGCGCCGGTGGGG No data
1041690276_1041690296 14 Left 1041690276 8:60680078-60680100 CCTTCCAACGCAACTCGGCTCCC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1041690296 8:60680115-60680137 GCCGGGGGTCAGCGCCGGTGGGG No data
1041690279_1041690296 -6 Left 1041690279 8:60680098-60680120 CCCCCGCCCCCCAACCCGCCGGG 0: 1
1: 1
2: 4
3: 94
4: 1187
Right 1041690296 8:60680115-60680137 GCCGGGGGTCAGCGCCGGTGGGG No data
1041690277_1041690296 10 Left 1041690277 8:60680082-60680104 CCAACGCAACTCGGCTCCCCCGC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1041690296 8:60680115-60680137 GCCGGGGGTCAGCGCCGGTGGGG No data
1041690281_1041690296 -7 Left 1041690281 8:60680099-60680121 CCCCGCCCCCCAACCCGCCGGGG 0: 1
1: 0
2: 3
3: 44
4: 418
Right 1041690296 8:60680115-60680137 GCCGGGGGTCAGCGCCGGTGGGG No data
1041690283_1041690296 -8 Left 1041690283 8:60680100-60680122 CCCGCCCCCCAACCCGCCGGGGG 0: 1
1: 0
2: 1
3: 29
4: 300
Right 1041690296 8:60680115-60680137 GCCGGGGGTCAGCGCCGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041690296 Original CRISPR GCCGGGGGTCAGCGCCGGTG GGG Intronic
No off target data available for this crispr