ID: 1041691333

View in Genome Browser
Species Human (GRCh38)
Location 8:60690864-60690886
Sequence ACTGAGCTGCAGAAAATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041691333_1041691335 -9 Left 1041691333 8:60690864-60690886 CCTGTCATTTTCTGCAGCTCAGT 0: 1
1: 0
2: 3
3: 20
4: 253
Right 1041691335 8:60690878-60690900 CAGCTCAGTATTTTCAGGTCAGG No data
1041691333_1041691336 -8 Left 1041691333 8:60690864-60690886 CCTGTCATTTTCTGCAGCTCAGT 0: 1
1: 0
2: 3
3: 20
4: 253
Right 1041691336 8:60690879-60690901 AGCTCAGTATTTTCAGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041691333 Original CRISPR ACTGAGCTGCAGAAAATGAC AGG (reversed) Intronic
900958228 1:5901708-5901730 GCTGTGCTGGATAAAATGACTGG + Intronic
901872490 1:12146125-12146147 TCTGAGCTGCAGAGAATGGCAGG - Intergenic
902244184 1:15108593-15108615 GCTGTGCTGGAGAAAATGAATGG - Intronic
903920186 1:26794472-26794494 GCAGAGCTGCATAAAAGGACTGG - Exonic
904461078 1:30680126-30680148 TGAGAGCTGCAGAGAATGACAGG + Intergenic
905447317 1:38035428-38035450 ACTGAGATTCAGAGAATGGCAGG + Intergenic
905576269 1:39047178-39047200 ACAGAGCTGCAGACAAGGAGTGG + Intergenic
905862462 1:41360894-41360916 ACTGAGCTGGGGAAAAAGAATGG - Intergenic
906392828 1:45433589-45433611 TCTGCGTTGCTGAAAATGACAGG + Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
909970593 1:81982154-81982176 ACTGAGATACAAAAGATGACTGG - Intronic
911679377 1:100697043-100697065 TCTGAGATCCAGAACATGACAGG - Intergenic
912195246 1:107390105-107390127 ACTGAGTTGTGGAAAATGAAAGG + Intronic
912511878 1:110195247-110195269 ACTGAGGTGGAGAAAAAGACTGG + Intronic
915588667 1:156858870-156858892 ACAGAGATGCAGACAGTGACAGG + Exonic
915872962 1:159581226-159581248 ACGGAGCTGCAGAAAGTCTCAGG + Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
921342944 1:214152911-214152933 ACTGTGCTGCAGAGAAACACAGG + Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923820843 1:237439209-237439231 CCTGAGCTACAGAAAATGACAGG + Intronic
1064673056 10:17735254-17735276 AGTGAGCTGCAGAACAAAACAGG - Intergenic
1066572087 10:36784486-36784508 AATCAGCTGCAGAAAGTGAATGG + Intergenic
1067002769 10:42633150-42633172 ACTGCGATGAAGAAAATGTCAGG - Intronic
1068326601 10:55497029-55497051 AGTGTTCTGTAGAAAATGACAGG + Intronic
1068524327 10:58110022-58110044 ACTGATGTGCAGAAAAAGAATGG + Intergenic
1069245911 10:66205794-66205816 ACTCAGCTACACATAATGACAGG - Intronic
1069816823 10:71201836-71201858 ACTGAGTTCCTGGAAATGACAGG + Intergenic
1073131352 10:101191026-101191048 AGTGAGGTGCAGAAGATGCCGGG - Intergenic
1073140173 10:101242092-101242114 GCTGGGCTGCAGATAATGCCAGG - Intergenic
1073910348 10:108335375-108335397 ATTGAGCTGGAGAAAAACACAGG + Intergenic
1073941891 10:108708860-108708882 GCTGAGATACAGAAAATGAGGGG - Intergenic
1075292198 10:121240307-121240329 AATGAGCTGCAGAATAAGAGGGG - Intergenic
1077999058 11:7478538-7478560 AGTGAGCTGCAGAAAGTGTTGGG + Intergenic
1078775283 11:14388367-14388389 ACTGAACTGAAGAACATCACAGG + Intergenic
1081255898 11:40894576-40894598 GCTGGGATGCAGAAAGTGACTGG - Intronic
1081848215 11:46256417-46256439 ACTGAGCTGCAGAACCAGCCTGG - Intergenic
1084266636 11:68008513-68008535 GCTGAGCTCCAGAGAATGGCAGG + Intergenic
1084750601 11:71202344-71202366 CCTGAGCTGCAGAGAGTGGCTGG - Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1086240586 11:84685535-84685557 AGTGAGCTGCAGGAAAAGAATGG - Intronic
1087077121 11:94135376-94135398 ACTCAGTTGCAGGAAATGAAAGG - Intronic
1088553076 11:111034374-111034396 TCTGTGCTGCAGAAAATGAATGG + Intergenic
1090219593 11:125007386-125007408 TCTGTGTTGCAGCAAATGACAGG + Intronic
1090468449 11:126956499-126956521 ACTGGGCTAAAGAAAATGACTGG + Intronic
1090545547 11:127762885-127762907 ATTGAGCAGCAGAAATTCACAGG + Intergenic
1090671265 11:128947307-128947329 ACTGGGCTGCAGGAAGTGAGTGG - Intergenic
1091397480 12:162975-162997 ACTGAGCCACAGTAAATGAGGGG - Intronic
1091724406 12:2835379-2835401 CCTGGGCTGCAGATAATGCCAGG - Intronic
1092740659 12:11626318-11626340 TCTGTGCTGCTGCAAATGACAGG - Intergenic
1092943861 12:13435451-13435473 GCTGAGCTCCATAAAATGCCTGG - Intergenic
1095455442 12:42379286-42379308 AATGAGCTACATAAAAGGACTGG - Intronic
1095569019 12:43660829-43660851 GCTAAGCTGAAGAAAAAGACTGG + Intergenic
1095579370 12:43779289-43779311 ACTGAGATGCAGAAAGTTATAGG + Intronic
1096243471 12:49971881-49971903 GCTGAGCTGCAGAAAACAAGAGG + Intronic
1096534806 12:52264663-52264685 ACTGAGCTTCAGTCAATCACAGG - Intronic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1098931857 12:76426171-76426193 GCTGAGCTTCAGACAATCACAGG + Intronic
1099079092 12:78153341-78153363 ACAGAGCTGCATAAAACCACAGG + Intronic
1100556068 12:95695186-95695208 ACTGAACTTCAGTAAATGAAAGG - Intronic
1100702842 12:97166194-97166216 ACTGAACTGCTGAGAATCACTGG - Intergenic
1101014451 12:100485115-100485137 ATAGAGCTGCAGAATGTGACTGG - Intronic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101894044 12:108741549-108741571 ACAGAGCTGCAGAATATGTGAGG - Intergenic
1103870883 12:124090728-124090750 ATTCAGCTGCAGAAAGTGAATGG + Intronic
1105730171 13:23205923-23205945 ACTAAGCTACAGAAAATGCCAGG + Intronic
1105864426 13:24446685-24446707 ACTGAGCTTCAGAAGACAACTGG - Exonic
1106871849 13:34030264-34030286 ACTGAGATGCAGAGGATTACAGG + Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108200625 13:48039417-48039439 CCTGAGCTGCAGAAACTCACAGG - Intronic
1108504198 13:51095939-51095961 ACTGACCTACATAAAATGCCTGG - Intergenic
1108561461 13:51648244-51648266 ACTGTGCTGCATAAGATGATGGG - Intronic
1109996676 13:70136152-70136174 ACTGAGCTTCAGCCAATCACAGG - Intergenic
1110688352 13:78401965-78401987 AGTGGACTGCAGAAAAGGACTGG - Intergenic
1110727659 13:78843837-78843859 CCTGAGCTGTGGAAAAAGACTGG - Intergenic
1111038588 13:82713278-82713300 GCTGCACTGCAGAAAATGATAGG + Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1116132451 14:40873836-40873858 ACTGAGCTTCAGCCAATCACAGG + Intergenic
1118269091 14:64325252-64325274 CCAGAGCTGCATAAAAGGACAGG - Intronic
1118657724 14:67970190-67970212 ACTGAGCAGCAAAAAATAACTGG - Intronic
1119107566 14:71938866-71938888 AGTTACCTGCAGAAGATGACAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120252202 14:82071496-82071518 ACAGATCTGCAGAGAATGACAGG - Intergenic
1121675585 14:95750037-95750059 GCTGAGGTGCAGGAAAAGACGGG + Intergenic
1121771500 14:96546866-96546888 CCTAAGCAGCAGAAAATGCCTGG - Intronic
1124116540 15:26848606-26848628 ACTGAGCTTCAGCCAATCACAGG + Intronic
1124200874 15:27677598-27677620 ACTGAGCTGAGAAAAATGTCAGG - Intergenic
1126714797 15:51503407-51503429 ACTGTGTTGCTGCAAATGACAGG - Intronic
1128843485 15:70870035-70870057 TCTGAGCTTCAGAAACTGAGAGG + Intronic
1132037200 15:98494251-98494273 ACTATGCTTCAGAAAAGGACAGG + Intronic
1132272423 15:100538131-100538153 ACAGAGCTGGCCAAAATGACAGG - Intronic
1132397182 15:101482473-101482495 GCTGAGCTGCAGAAGATCAGAGG + Intronic
1132852024 16:2029080-2029102 ACTGCACGGCAGAGAATGACGGG + Intronic
1133576988 16:7101484-7101506 ACTGAGATTCAGAAAGAGACCGG + Intronic
1133850369 16:9497770-9497792 ACTGAGTTGAAGAGAAAGACTGG + Intergenic
1134028073 16:10969818-10969840 ACTGAGGTTCAGAAAGGGACTGG - Intronic
1141638741 16:85329212-85329234 ACTGAGGTGCAGAAAAGCTCAGG - Intergenic
1142794179 17:2294469-2294491 ACTGAGGTACAGAAAGTGACCGG - Intronic
1143466537 17:7140539-7140561 ATCGAGCTGCAGACATTGACAGG - Intergenic
1143938950 17:10518338-10518360 ACTGAGAACCAGGAAATGACTGG + Intronic
1144530308 17:16032278-16032300 ACTGAACTGCACAAAGTGAGGGG - Exonic
1147491595 17:40872905-40872927 AGCGAGTTGCAGAAAATGACAGG - Intergenic
1149583251 17:57766479-57766501 ACTGAGCTTTAGAAATTGATGGG + Intergenic
1150475889 17:65474605-65474627 AATGAGATGCAGAAAATGACAGG + Intergenic
1150742257 17:67788761-67788783 ACTGAGGTGAAAAAAATCACTGG - Intergenic
1158601572 18:58860255-58860277 ACTGAGGTTCAGAAAAGGAGAGG + Intergenic
1160473615 18:79162891-79162913 AGTGTGCTGAAGAAACTGACAGG - Intronic
1160849443 19:1183412-1183434 ATTGAGCTACAGAAAATGCGAGG + Intronic
1163842990 19:19622758-19622780 TCTGAGCTGCAGAGAAAGACAGG + Intergenic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164842824 19:31406288-31406310 ACTGGGCTGCAGAGTGTGACTGG - Intergenic
1164943060 19:32266558-32266580 ATTGAGCTGCAGAACGTGAACGG + Intergenic
1165280042 19:34788296-34788318 ACTGAGATGGAGACAGTGACTGG - Intergenic
925499410 2:4486952-4486974 AATAATCTGCAGAAAATGGCAGG + Intergenic
925686900 2:6482188-6482210 ACACAGCTGCAGAAACTGGCCGG + Intergenic
925910749 2:8572055-8572077 ACTGAGCTGCAGACTAGGCCGGG + Intergenic
926233216 2:11020422-11020444 ACTGAGCTCCCGGACATGACAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
927570895 2:24158859-24158881 ACTGAGCAGCTTGAAATGACAGG + Intronic
929838912 2:45435377-45435399 ACTGAGCTGGAGAAACAGACTGG + Intronic
930663221 2:54076234-54076256 ACTGGGCTTGAGAAAATGGCGGG + Intronic
930978190 2:57489936-57489958 ATTGAGGTGGAGAAAATGAAGGG + Intergenic
931182061 2:59912286-59912308 CATGAAATGCAGAAAATGACAGG - Intergenic
932548497 2:72741323-72741345 ACTGAACTGCTGAAAGTGAGAGG - Exonic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
934040805 2:88126189-88126211 TGTGAGCTGGAGACAATGACAGG - Exonic
938207648 2:129437852-129437874 ACTGAGCTGCAGTCAATGTGGGG - Intergenic
938914241 2:135918959-135918981 ACAAAGCTGCAGAGAATGCCTGG + Intronic
939966316 2:148613779-148613801 CCTGAGCTACAGAAAGAGACTGG + Intergenic
940064479 2:149611860-149611882 ACTGAGTTTCAGAAACTCACTGG + Intergenic
940414902 2:153408324-153408346 ATACATCTGCAGAAAATGACCGG + Intergenic
940436416 2:153661325-153661347 ACTCAGCTGCTCAAAATCACTGG + Intergenic
940500024 2:154482214-154482236 ACTGAAATGCAGAAGATGGCTGG + Intergenic
940528953 2:154855008-154855030 TCTAAGCTGCAGAAAATTACTGG + Exonic
942418302 2:175781485-175781507 ACTGAGCTGCATAATATGGCAGG - Intergenic
944498061 2:200328615-200328637 ATTGACCTCCACAAAATGACTGG - Intronic
945642175 2:212443808-212443830 ACTTATCTGCAGAACATGGCAGG - Intronic
946767905 2:223057208-223057230 ACTGTGCTGAAGAAAATCACAGG + Intronic
948083089 2:235223231-235223253 AATGAGCTCCATAAAATGACTGG - Intergenic
948586129 2:239020868-239020890 ACAGAGGTGCAGAAAACCACTGG + Intergenic
1173658761 20:44718753-44718775 ACTGAGCTCCAGAGAGGGACAGG - Intronic
1173688414 20:44940134-44940156 ACTGGGCTGAAGAAAAAAACAGG - Intronic
1175600213 20:60266872-60266894 CCTTAGCTGCAGCAAATGAAGGG - Intergenic
1178751150 21:35304206-35304228 ACAGAGCTGCAGAATATTAATGG - Intronic
1178968943 21:37153913-37153935 ACTGAGCTGTGGTAAATCACAGG + Intronic
1179522712 21:41955514-41955536 ATACAGCTGCAGAAAATAACAGG - Intergenic
1181958285 22:26604233-26604255 ACTCAGAAGTAGAAAATGACTGG - Intronic
1182174988 22:28275929-28275951 ACTGATCTACAGAAAGTGACAGG + Intronic
1182685132 22:32116542-32116564 ACTGAGGTCCATAAAATAACTGG - Intergenic
1182965150 22:34514547-34514569 ACTGAGCTACAGGGAATGAAAGG + Intergenic
1184565020 22:45286631-45286653 AATGAGCTGTTGTAAATGACTGG - Intronic
949437179 3:4042093-4042115 ACTGAGTTGCAGAAATTAAGTGG - Intronic
951907305 3:27717781-27717803 ACACCGCTTCAGAAAATGACAGG - Exonic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957843924 3:85705882-85705904 ACTTCGCTGCAGATAATGAAAGG - Intronic
959505793 3:107155356-107155378 ACTGAGGAGCAGAAAAGGAAAGG + Intergenic
960579051 3:119258236-119258258 GCTGAGCTTCAGACAATCACAGG - Intergenic
962337670 3:134550917-134550939 ACTGGGCTGGTAAAAATGACTGG + Intronic
962953939 3:140247118-140247140 AGTGAGCTGCAGATCATGAAAGG + Intronic
963156931 3:142109262-142109284 ACTTGGCAGCAGAAAATGAAAGG + Intronic
964880454 3:161417643-161417665 CCTCAGCTTAAGAAAATGACAGG + Intergenic
965762253 3:172092171-172092193 ACAGAGCAGCACAGAATGACAGG + Intronic
967341681 3:188405597-188405619 GCTGAGATGCAGAAAAAGATAGG - Intronic
968573951 4:1356319-1356341 ACTGACCTGGGGAAAACGACAGG - Intronic
968741507 4:2333853-2333875 ACTCACTTGAAGAAAATGACAGG - Intronic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
971385785 4:26139502-26139524 ACTGAGCTGCAGGCTGTGACTGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
972156526 4:36169887-36169909 ACTGACCAGCATAAATTGACTGG + Intronic
972906615 4:43756588-43756610 ACGGAGCTGTAGAAATGGACAGG - Intergenic
974355379 4:60806188-60806210 GCTGGGATGCAGACAATGACAGG + Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
980868276 4:138579806-138579828 TCCGTGCTGCTGAAAATGACAGG + Intergenic
981115815 4:140989950-140989972 ACTTACCTGCATAAAAAGACTGG + Intronic
982474357 4:155832113-155832135 AATGAGGTGCAGAAAATTATTGG - Intronic
982643223 4:157988846-157988868 ACTGAGATGCAAAAAAAAACAGG + Intergenic
983008615 4:162517757-162517779 ACTTAACTGCAGAATATCACTGG + Intergenic
984038822 4:174703734-174703756 ACTGAGCCTCTGAAAATGAGCGG + Intronic
984541847 4:181048365-181048387 ACTGTGTTGCAGAGAATGGCAGG + Intergenic
986377515 5:7147720-7147742 ACTGAGCTGCAGGAAATACAAGG + Intergenic
987843380 5:23250193-23250215 ACTGAGCTTCAGAAAATTCAAGG - Intergenic
988247953 5:28713271-28713293 AATGTGCTGCTGCAAATGACAGG - Intergenic
990817245 5:59799265-59799287 AGTTAACTGCAGAGAATGACTGG + Intronic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992908175 5:81368924-81368946 ACTGACCTGAAGTAAATGAGTGG + Intronic
993866775 5:93205273-93205295 ACTGAAATCCAAAAAATGACTGG + Intergenic
994580066 5:101630093-101630115 ACTTAGGTGCAGAAAATAAATGG + Intergenic
996493552 5:124127500-124127522 AAAGAGCTGAAGAAAATAACAGG + Intergenic
997779901 5:136646199-136646221 ACTGGGATTCAGAAAATGAATGG - Intergenic
999051113 5:148524755-148524777 AGTGAACTGCATAAAATGAGGGG - Intronic
999143042 5:149375310-149375332 ACCGAGGTGCAGAAAAGGAGAGG - Intronic
999925269 5:156369045-156369067 TCAGAGCTGCAGAGAATTACAGG - Intronic
999960239 5:156747338-156747360 CCTGACCTACAGAAAATGAAAGG - Intronic
1001397354 5:171426862-171426884 ACTGAGGTGCAGAAAATTGAAGG - Intronic
1002764089 6:224888-224910 ACTGAGCTTCTGAAAAGGAGAGG - Intergenic
1005699368 6:28384402-28384424 ACTGGGCTTAGGAAAATGACTGG + Intronic
1006277730 6:33019566-33019588 ACTGAGCTGCAAACCATGAGAGG - Intergenic
1008081474 6:47199272-47199294 ACTGGAGTGCAGAAAATGATAGG - Intergenic
1008613111 6:53202234-53202256 AGTGAGCTGAAAAAAAAGACTGG - Intergenic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009413483 6:63392813-63392835 ACCGAGCTGCAGACATTGATTGG + Intergenic
1011559384 6:88599458-88599480 ACTGTGGTGCAGAAAATCAATGG - Intergenic
1012354432 6:98296038-98296060 ACTCAGGAGCAGACAATGACAGG - Intergenic
1013804139 6:113978535-113978557 ACTGACGTGCAGAAAATGTTTGG - Intronic
1014521370 6:122446863-122446885 ACCGAGCTGTAGATAATGAAAGG - Exonic
1014670253 6:124294859-124294881 GCTGTGTTTCAGAAAATGACAGG - Intronic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015528264 6:134194279-134194301 ACTGAGCTTCAGCCAATCACAGG + Intronic
1016428675 6:143960273-143960295 ACTGAGCTTTAAAAAATGAAAGG + Intronic
1017174893 6:151493889-151493911 ACTGAGCGGCCGAAACTGCCAGG - Intergenic
1017186862 6:151610371-151610393 TCTAAGCTGTAGAAAATGGCAGG + Intronic
1017638296 6:156465294-156465316 ACTGAGAGCCAGAAAATGAGGGG + Intergenic
1017655364 6:156622592-156622614 TCTTAGAAGCAGAAAATGACTGG + Intergenic
1017673328 6:156788504-156788526 GATGATCTGCAAAAAATGACTGG + Intronic
1018205927 6:161436879-161436901 ACAGAGCTGCAGAGGGTGACCGG - Intronic
1019165587 6:170095688-170095710 ATTGAGCTGCAGAGAAGGAAGGG - Intergenic
1021910616 7:25382615-25382637 TCTGAGCTGAAGACAATGAGGGG - Intergenic
1022476174 7:30711563-30711585 ACTGCAATGCAGAAAATCACTGG - Intronic
1023314398 7:38920457-38920479 ACTTATCTGCACAGAATGACAGG - Intronic
1024465780 7:49710353-49710375 ACTGAGGCTCAGAAAATGTCAGG + Intergenic
1026624846 7:71982806-71982828 ACTGAGCTGCAGACATAGAAAGG + Intronic
1027445362 7:78267282-78267304 GCTGAGCTTCATAAAATGGCTGG + Intronic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1028320700 7:89456341-89456363 ACTGAGCTGTAAAAACTTACAGG - Intergenic
1029614579 7:101648304-101648326 ACTGAGGTCCAGAAAAGAACAGG + Intergenic
1029956160 7:104642535-104642557 ACTGAGCTCTAGAAATTGAAGGG - Intronic
1030639492 7:111988124-111988146 ACAGAAATGAAGAAAATGACAGG - Intronic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1033521634 7:142166814-142166836 ACTGAGTGGCATAGAATGACAGG + Intronic
1037502934 8:19502726-19502748 AATGAGCTACAGCAAGTGACAGG - Intronic
1039790411 8:40871533-40871555 ACTGAGCTGCAGAGAAGGCTGGG + Intronic
1040586260 8:48745293-48745315 ACTGATCTGTAAAAAATGACAGG - Intergenic
1041691333 8:60690864-60690886 ACTGAGCTGCAGAAAATGACAGG - Intronic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042123831 8:65516738-65516760 ACTGAGTTTCAGAAAATGCAAGG + Intergenic
1043665995 8:82814812-82814834 CCTATGTTGCAGAAAATGACAGG + Intergenic
1043927829 8:86057983-86058005 ACTGAGCTGAACAAAATTTCTGG + Intronic
1044083315 8:87911904-87911926 AATAAGCTGCAGAAATTGATAGG + Intergenic
1044254300 8:90042297-90042319 ACTGAACTCCAGAAAATGTGAGG + Intronic
1044312795 8:90713381-90713403 ACAGAGCTGCAAAATATAACTGG + Intronic
1044492564 8:92836485-92836507 ACTGAGCTGCAGAAAATCAGTGG + Intergenic
1045981824 8:108198523-108198545 ACTGAGCTGAAGAAATAGAATGG - Intergenic
1046785517 8:118261796-118261818 TCTGTGCTCCATAAAATGACAGG - Intronic
1047431804 8:124799273-124799295 ACTGAGTTTCAGGGAATGACTGG - Intergenic
1047911726 8:129537166-129537188 ACTTAGCTGCAGAATAAAACTGG + Intergenic
1048396004 8:134014553-134014575 ACTGAGCTGCTTAAAATATCAGG - Intergenic
1049692204 8:143966356-143966378 ACTGAGGTGCAGGAAATGCTGGG - Intronic
1050076606 9:1872232-1872254 TCTGACCTGGAGAAAATGTCAGG + Intergenic
1051067448 9:13121772-13121794 ATTGAGCTGCAGAAGAAGCCGGG - Exonic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1053416135 9:37947908-37947930 ACTGAGGTCCAGAAAAAGAAGGG - Intronic
1054725077 9:68641973-68641995 AGAGTGCTGCAGAAAATCACCGG + Intergenic
1055863527 9:80784478-80784500 AATAAACTGCAGATAATGACAGG - Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056232153 9:84557775-84557797 ACTGAGCTGTAGGAATAGACTGG + Intergenic
1060228977 9:121813351-121813373 ACTGACCCGCAGAGATTGACAGG - Intergenic
1060780706 9:126410389-126410411 ACACAGCTGAAGAAAATGGCTGG - Intronic
1189107026 X:38247102-38247124 ACTGAGCTGCAGAGAATAATGGG + Intronic
1189228285 X:39431985-39432007 ACTGAGCTGCAGGATATTAAAGG - Intergenic
1189378135 X:40481643-40481665 ACTGGGCTGCAGAACTTCACAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1194011469 X:88567542-88567564 ACTGTGCAGCAGAAAATGGCAGG + Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194992976 X:100564574-100564596 ACTCATTTGCAGAAATTGACAGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197188636 X:123619431-123619453 ACTGTCCTGTAGAAAATGAATGG + Exonic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198732436 X:139746773-139746795 GCAGAGCTGCAGAAAAAGATGGG + Intronic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic