ID: 1041692489

View in Genome Browser
Species Human (GRCh38)
Location 8:60702551-60702573
Sequence GAAGGTGGAGACTGTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041692485_1041692489 30 Left 1041692485 8:60702498-60702520 CCTTAAGTAAATAAAGCTTTTAA 0: 1
1: 1
2: 3
3: 50
4: 564
Right 1041692489 8:60702551-60702573 GAAGGTGGAGACTGTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041692489 Original CRISPR GAAGGTGGAGACTGTGATCT TGG Intronic
No off target data available for this crispr