ID: 1041693057

View in Genome Browser
Species Human (GRCh38)
Location 8:60708528-60708550
Sequence CTTCCCTTCACCTGGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041693052_1041693057 10 Left 1041693052 8:60708495-60708517 CCAGCTTTGCATTTAACCCTTGA 0: 1
1: 0
2: 1
3: 14
4: 143
Right 1041693057 8:60708528-60708550 CTTCCCTTCACCTGGGATGCAGG No data
1041693053_1041693057 -6 Left 1041693053 8:60708511-60708533 CCCTTGAAAACAGATTGCTTCCC 0: 1
1: 0
2: 3
3: 15
4: 174
Right 1041693057 8:60708528-60708550 CTTCCCTTCACCTGGGATGCAGG No data
1041693054_1041693057 -7 Left 1041693054 8:60708512-60708534 CCTTGAAAACAGATTGCTTCCCT 0: 1
1: 0
2: 1
3: 19
4: 240
Right 1041693057 8:60708528-60708550 CTTCCCTTCACCTGGGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041693057 Original CRISPR CTTCCCTTCACCTGGGATGC AGG Intronic
No off target data available for this crispr