ID: 1041697459

View in Genome Browser
Species Human (GRCh38)
Location 8:60751270-60751292
Sequence ATGCATATTAATAAAAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 789
Summary {0: 1, 1: 0, 2: 1, 3: 66, 4: 721}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041697459 Original CRISPR ATGCATATTAATAAAAATGA AGG (reversed) Intronic
903165633 1:21518514-21518536 ATGGATATTATTACAAAGGATGG + Intronic
904132380 1:28284534-28284556 ATGCATTTAAAAAAAAATAATGG + Intergenic
904837948 1:33350825-33350847 ATGAATATTAATGAAAAGGGGGG - Intronic
905679574 1:39858945-39858967 ATGCACATTAAGAAAACTAAAGG + Intronic
905834094 1:41101984-41102006 ATGCCTAGTTATAATAATGAAGG + Intronic
907073643 1:51559566-51559588 ATGCATATGAATAAAATGGGGGG - Intergenic
907792384 1:57679688-57679710 ATGCATAATTATATATATGATGG - Intronic
908111801 1:60905191-60905213 ATAAAGATTGATAAAAATGAAGG + Intronic
908169776 1:61493166-61493188 AAGTATATTAATACAAAAGAGGG + Intergenic
908800992 1:67880648-67880670 TTGCAGATTCCTAAAAATGAGGG - Intergenic
908936168 1:69378709-69378731 ATGTATATAAATAAAAAACAAGG - Intergenic
908962935 1:69723557-69723579 ATGAATAGTCATGAAAATGAAGG - Intronic
909124396 1:71647429-71647451 ATGAATAAAAATAAAAATGTGGG - Intronic
909497889 1:76299856-76299878 ATGCATATTTCTTAAAATAAAGG - Intronic
909723649 1:78808309-78808331 ATGCATTTAAATGAAAAAGAAGG + Intergenic
909839244 1:80297715-80297737 CTTAATATTAATATAAATGAGGG + Intergenic
909945424 1:81657945-81657967 AAGCATAAAAATAAAAAGGATGG + Intronic
910092806 1:83485477-83485499 ATGTAGAATAATAAAAATCATGG - Intergenic
910594607 1:88966204-88966226 ATACATATTAATAAATAAGTGGG + Intronic
910652885 1:89588990-89589012 AGGCCCACTAATAAAAATGATGG - Intronic
910671813 1:89781336-89781358 ATGTATAATAATAATAAAGATGG + Intronic
911118297 1:94269580-94269602 ATATATTTTAATAACAATGATGG + Intronic
911208365 1:95115737-95115759 ATGCATATCAAAGATAATGATGG + Intergenic
911448030 1:98024135-98024157 ATGCTCATTAATGAAACTGAAGG + Intergenic
911487894 1:98525592-98525614 CAGCATATTAATAAAGATGGAGG - Intergenic
911904033 1:103542972-103542994 TTGCATATTAATAAATATCCTGG + Intronic
912000531 1:104828804-104828826 ATGAAAATTAATAATATTGATGG - Intergenic
912096653 1:106152824-106152846 ATACTAGTTAATAAAAATGATGG + Intergenic
912104540 1:106255715-106255737 ATTCATCTTAATAATAATTAAGG + Intergenic
912109507 1:106323606-106323628 TTGCTTATTACTAAAAATGGTGG - Intergenic
915746325 1:158161883-158161905 ATGAATACTAAGAAAAACGAGGG + Intergenic
916278338 1:163020239-163020261 ATAGATGTTAATAAAAGTGATGG + Intergenic
916393755 1:164362455-164362477 TTGCCTATGAATAAAAATGTCGG + Intergenic
916502371 1:165397845-165397867 ATGAATAATAATAATAATAATGG + Intergenic
917320751 1:173778847-173778869 AGGCAGATTAAGAAAAAAGAAGG - Intronic
917455905 1:175185597-175185619 AAGTATGTTGATAAAAATGAGGG + Intronic
918339333 1:183554482-183554504 AGGAATAAAAATAAAAATGATGG - Intronic
918827928 1:189350986-189351008 AGGCACTGTAATAAAAATGAGGG + Intergenic
919282265 1:195506310-195506332 CTGCATATGAATCAAAATAAAGG + Intergenic
919583754 1:199409838-199409860 GTGCATAATAATAATAATGTAGG - Intergenic
919625016 1:199903137-199903159 ATGCCTATTAATGAAAATAATGG + Intergenic
920151038 1:203907989-203908011 AAGTAAATAAATAAAAATGAAGG + Intergenic
920286742 1:204885111-204885133 TTACATATTAAAAAAAAAGATGG - Intronic
921114497 1:212075519-212075541 ATTTATTTGAATAAAAATGAAGG + Intronic
921289546 1:213644644-213644666 ATGCATATTACTAAAATGAAAGG - Intergenic
921665201 1:217861397-217861419 ATATATATTTATAAAAATAAAGG + Intronic
922380904 1:225024445-225024467 AGGAATATTAATTGAAATGATGG + Intronic
922673644 1:227534775-227534797 CTGCATAGTAAAAAAAAGGAAGG - Intergenic
923213569 1:231829243-231829265 ATGCTTATTATTAGAAAGGATGG - Intronic
923439964 1:234007973-234007995 ATGCATTTAAGGAAAAATGAAGG + Intronic
923782192 1:237034882-237034904 ATTGATAATAATAATAATGATGG + Intergenic
924258448 1:242205475-242205497 GTGCATCTTAAAACAAATGAGGG - Intronic
924446464 1:244137227-244137249 ATGCATGATAATAAAAAATAAGG + Intergenic
1063071422 10:2670497-2670519 ATGCATATGAATGCAATTGATGG + Intergenic
1063573558 10:7240028-7240050 ACACATATTATTAAAAATGGAGG - Intronic
1063737431 10:8775781-8775803 ATTCATCTTAATTAAAATAAAGG - Intergenic
1063803564 10:9611057-9611079 ATGGATATAAACAAAAATGAAGG + Intergenic
1063806690 10:9652967-9652989 ATGCATATTAAAATGAAAGATGG + Intergenic
1064141047 10:12790638-12790660 ATGTAAATTAAAAAAAATGAAGG - Intronic
1064581882 10:16802061-16802083 AAAAATATTAATAAAAATTAGGG + Intronic
1064897255 10:20251780-20251802 ATGTATACTAAGAAAAATTAAGG - Intronic
1065104709 10:22371215-22371237 ATCCATATCAATGAAAATGGAGG + Intronic
1065482375 10:26208831-26208853 ATGCAAATGAATGAAAATAATGG - Intronic
1065555300 10:26909286-26909308 TTGCTTATTAATAAAATTTAGGG + Intergenic
1066488296 10:35870572-35870594 ATGTAAATGAAAAAAAATGAAGG - Intergenic
1066564305 10:36704884-36704906 ATGTATATTAAGAATAATCATGG + Intergenic
1067302848 10:45028912-45028934 ATCCATATAAAGAAAAAAGACGG - Intergenic
1067495984 10:46760473-46760495 AAGCAAACTAATAAAATTGAAGG - Intergenic
1067598672 10:47579916-47579938 AAGCAAACTAATAAAATTGAAGG + Intergenic
1068067828 10:52154043-52154065 TTGAATAAAAATAAAAATGAAGG - Intronic
1068260782 10:54578295-54578317 ACTCATATTTATAAAAATGATGG - Intronic
1068328602 10:55530273-55530295 ATGGATAAGAATAATAATGATGG - Intronic
1068520533 10:58072491-58072513 ATTCATCATAATACAAATGAGGG + Intergenic
1068574577 10:58670847-58670869 ATACTCATTAATAAAAAGGAAGG + Intronic
1068840483 10:61608225-61608247 ATGTTTATTTCTAAAAATGAAGG + Intergenic
1069370828 10:67746369-67746391 ATGCACATGAATGAAACTGAGGG + Intergenic
1069586311 10:69605421-69605443 AAGAATATTAAAAAAAATAATGG + Intergenic
1070580532 10:77715752-77715774 AAGCATGTTAATTAGAATGAGGG - Intergenic
1071085524 10:81864402-81864424 ATGCATTTTAACAAACAGGAAGG - Intergenic
1071175344 10:82919754-82919776 ATGGATATTGATACAAATTATGG - Intronic
1071746011 10:88420204-88420226 ATGTATAATAATAAAAATATTGG - Intronic
1072327011 10:94308808-94308830 ATGGAAATTAATAACAATAATGG + Intronic
1072771182 10:98139813-98139835 ACAAATATTAATAAAACTGAAGG - Intronic
1072936289 10:99716753-99716775 ATGCAAAGAATTAAAAATGAGGG - Intronic
1073273366 10:102286685-102286707 ATTTGTATGAATAAAAATGAAGG - Intronic
1073530756 10:104230162-104230184 ATGTATATTAAAAAAAAAAATGG + Intronic
1073707622 10:106003152-106003174 TGGCATATTGATAAAAATGAGGG + Intergenic
1073896846 10:108171009-108171031 ATGCAGCTTTATAAAAAAGAAGG - Intergenic
1074439424 10:113461881-113461903 ATGCAAATGAATAAAAACAAAGG + Intergenic
1074594599 10:114850117-114850139 ATGCTTAGTAGTAAAATTGATGG + Intronic
1075770390 10:124929645-124929667 ATTCTTATTCATAAAAATGGAGG + Intergenic
1076109472 10:127849747-127849769 ATGCACATTTAACAAAATGAAGG + Intergenic
1078294545 11:10054872-10054894 ATGCAAACAAATAAAAATAATGG - Intronic
1078964005 11:16315355-16315377 ATGCATTTTATTAAAACTCAAGG - Intronic
1079236525 11:18694750-18694772 ATAAATAAAAATAAAAATGAAGG - Intronic
1079425661 11:20340114-20340136 ATCCATATTCCTAAAGATGAAGG + Intergenic
1079473021 11:20798039-20798061 AGGCATAAAGATAAAAATGATGG - Intronic
1079666759 11:23115423-23115445 TTTCCTATTAATAAAAATGTAGG + Intergenic
1079741722 11:24070645-24070667 ATTCATTTGCATAAAAATGAGGG - Intergenic
1079886670 11:25999256-25999278 ATCAAGATGAATAAAAATGAAGG - Intergenic
1080909794 11:36584083-36584105 ATGCATATAAATCTAAATGATGG + Intronic
1081153976 11:39666309-39666331 ATGAATATTAACAAATATTAAGG - Intergenic
1081170675 11:39866764-39866786 ATGCATATTATTAAAAAGGGAGG - Intergenic
1081295059 11:41375858-41375880 ATGAATATTAATATAAATTTAGG - Intronic
1081948911 11:47025420-47025442 ATTCAAAATAATAAAATTGAAGG - Intronic
1082313422 11:50684779-50684801 ATGCAGATTATTCAAAAAGAAGG - Intergenic
1082692194 11:56320179-56320201 GTGCATATTGATAAAAATTATGG - Intergenic
1083281905 11:61632113-61632135 ATGAAAATTAATAATAATGTGGG - Intergenic
1084132167 11:67144552-67144574 ATTTATATTAAAAAAAATGTTGG - Intronic
1084923316 11:72490671-72490693 TTAGATATTAAGAAAAATGATGG + Intergenic
1085705743 11:78785668-78785690 ATTAATATTAATAATAATAATGG - Intronic
1085913223 11:80853210-80853232 ATGAAAGGTAATAAAAATGAAGG + Intergenic
1085985059 11:81776831-81776853 ATTCATGTAAATAAAAATTATGG + Intergenic
1086814929 11:91358468-91358490 TGGCAAATTAATACAAATGATGG - Intergenic
1086982326 11:93212203-93212225 ATTCATATTGTTAGAAATGACGG - Intergenic
1087190140 11:95245487-95245509 AAGCAGATTAATAAAAGGGATGG - Intergenic
1087346996 11:96983929-96983951 CTTCATATTAGTAAAAATTATGG + Intergenic
1087358036 11:97120485-97120507 ACATATATTAATAATAATGAAGG + Intergenic
1087606086 11:100380114-100380136 ATGCATATATATAAACATTATGG + Intergenic
1087687378 11:101280446-101280468 ATACATATTAAAAAAAAAGTTGG - Intergenic
1087991118 11:104745972-104745994 CTGCATAATAATAAAAATTTTGG + Intergenic
1087999406 11:104857600-104857622 ATGCATATAACTTAAAATAATGG + Intergenic
1088025114 11:105170423-105170445 ATGGATTTTAATAAGAATAATGG - Intergenic
1088213094 11:107477860-107477882 ATACAAATTAATAGAAATTATGG + Intergenic
1088321578 11:108559649-108559671 ATTCTTATTAATGAAAATGAAGG - Intronic
1089089136 11:115852739-115852761 ATCAAAAATAATAAAAATGATGG - Intergenic
1089142248 11:116295008-116295030 ATATATATTCATAAAAATAAGGG - Intergenic
1089369620 11:117946133-117946155 AGGCACAAGAATAAAAATGAGGG + Intergenic
1089802398 11:121044622-121044644 ATGCATATTAATCAAAATATAGG - Intronic
1089879743 11:121762454-121762476 ATGTAAATTAATTAAAAAGAAGG + Intergenic
1090578851 11:128138243-128138265 CTGAATATTAACATAAATGATGG + Intergenic
1090800204 11:130166166-130166188 ATACATATGATTAAAAATTATGG + Intronic
1091738873 12:2945664-2945686 AAGAACATTAATAAAAATTATGG - Intergenic
1091860629 12:3779133-3779155 ATACATAATAATAAATATAATGG - Intergenic
1092752484 12:11731739-11731761 ATGCAAATTAATGACTATGAAGG - Intronic
1093106022 12:15088067-15088089 ATGGATATGAATAAAAAAAAGGG + Intergenic
1093338644 12:17942782-17942804 CTGGATATTGATAAAAATGTTGG - Intergenic
1093602590 12:21046873-21046895 ATGCATATGAAAAATATTGAAGG + Intronic
1093672612 12:21895749-21895771 ATGAATATTAATAACACTGCTGG - Intronic
1093922406 12:24874009-24874031 ATGAAGATTATTAAAAATGAAGG + Intronic
1094028313 12:25982486-25982508 ATGAATATAAATAAAAATGCTGG + Intronic
1094416921 12:30226736-30226758 ATGCACATTACTAATCATGAGGG + Intergenic
1094798745 12:34005108-34005130 ATGAAAATTAAGAACAATGAAGG + Intergenic
1095371901 12:41477684-41477706 ATGAATATAAATATAAATGATGG + Intronic
1095501949 12:42848993-42849015 ATGACTATACATAAAAATGAAGG - Intergenic
1095737437 12:45573193-45573215 CTGGAGCTTAATAAAAATGAAGG + Intergenic
1096025891 12:48360658-48360680 ATACATAAAAATAAAAATAAAGG + Intergenic
1097035529 12:56121219-56121241 ATTCATATGACTCAAAATGAGGG - Exonic
1097162620 12:57059249-57059271 ATCCATATTAATAAATATGTAGG + Exonic
1097581249 12:61459480-61459502 AAGTATAATAATAAAAAGGAAGG + Intergenic
1097924969 12:65117175-65117197 ATGGATATAAATAAAAATTTAGG - Intronic
1099146253 12:79046694-79046716 ATACATATTAATAGATATGTAGG - Intronic
1099559185 12:84150669-84150691 TTGCACAATAATAAAAAGGAAGG - Intergenic
1100076865 12:90795712-90795734 ATGCACAATAATTAAAACGAAGG + Intergenic
1100177346 12:92045893-92045915 ATTCATAGAAATGAAAATGAGGG - Intronic
1100682608 12:96944523-96944545 ATGTAGGTTAATAGAAATGAAGG - Intronic
1100724580 12:97395224-97395246 ATCCCTATTAATATTAATGAAGG - Intergenic
1100867968 12:98877733-98877755 ATTCTTCTTAATAAAAATAAGGG - Intronic
1101775133 12:107786712-107786734 ATGCCAATTAATAAATATGGAGG - Intergenic
1102527725 12:113523995-113524017 ATAAATATAAATAAAAAAGATGG - Intergenic
1102817651 12:115880650-115880672 ATGCAAATTCAGAAAAATAATGG + Intergenic
1102835353 12:116052905-116052927 ATGCATTTCAGTAAAACTGATGG + Intronic
1102933146 12:116877627-116877649 ATGCACAATAATAATCATGATGG + Intronic
1104188668 12:126457215-126457237 ATACATTTTAGTACAAATGAAGG - Intergenic
1104501212 12:129287326-129287348 ATGTAAATTAATAAACAGGAAGG + Intronic
1104541937 12:129673860-129673882 ATGGATGTTAACTAAAATGATGG + Intronic
1105483849 13:20806367-20806389 TTGCATACTAAAAAGAATGAAGG + Intronic
1105488376 13:20860341-20860363 ATAAATATAAATAAATATGAAGG + Intronic
1106057359 13:26251219-26251241 ATGGACATTAATAATAATAAAGG - Intergenic
1106478751 13:30120573-30120595 TTGCAAATCAACAAAAATGATGG + Intergenic
1106996222 13:35485175-35485197 ATTCATATTATGAAAAAAGATGG + Intronic
1107272759 13:38639810-38639832 ATACAAAATAATAAAAATTAAGG + Intergenic
1107850204 13:44563608-44563630 GAGAATATTAATAAAAATGGGGG - Intronic
1108088854 13:46824560-46824582 TTGGACATTAATAAAAATAAAGG - Intergenic
1108088999 13:46825896-46825918 ATAGATATTAATACAAATCAGGG - Intergenic
1108423575 13:50275084-50275106 ATGCCTATTTAAAAAAAAGAGGG - Intronic
1108770102 13:53689580-53689602 ATCCATATTAAGAATAATAATGG - Intergenic
1108972880 13:56399827-56399849 ATACATATTAAAAAAAATAGAGG + Intergenic
1109103130 13:58211974-58211996 ATTCATTTAAATAAAAATAAGGG - Intergenic
1109171572 13:59104482-59104504 ATGCATATTAAGTAAGATGGTGG + Intergenic
1109232606 13:59777359-59777381 ATACATAGTAATAAAAATGTAGG + Intronic
1109264531 13:60182236-60182258 ATACTTATGAATAAAAATAAAGG - Intergenic
1109330782 13:60927210-60927232 ATACATTTTAATATAAGTGATGG - Intergenic
1109446918 13:62451798-62451820 ATGAATGTTAAAAGAAATGAAGG + Intergenic
1109495478 13:63165666-63165688 GTGCATATATATAAAAAAGAAGG + Intergenic
1109560866 13:64048271-64048293 ATGCATTTTAATAAATAGTAAGG - Intergenic
1109833793 13:67828520-67828542 ATGCATTTTTACAAAATTGAAGG + Intergenic
1109950525 13:69497314-69497336 TTCCATATTAAGAAAGATGATGG - Intergenic
1110365191 13:74675071-74675093 ATGCATTTTAAAGAAAATTAAGG - Intergenic
1110938980 13:81325340-81325362 ATACATATTAATAAATATTTTGG + Intergenic
1110950554 13:81484098-81484120 GGGCATATTATTAAATATGAAGG - Intergenic
1111005926 13:82248700-82248722 ATGCATATGGATAAAACAGATGG + Intergenic
1111019469 13:82428299-82428321 AGGGATATAAATAAAAATTATGG + Intergenic
1111206931 13:85022487-85022509 ATGCATAATAGAAAATATGAAGG - Intergenic
1111307714 13:86436704-86436726 ATGCTTATTATTAACAAAGATGG - Intergenic
1111523947 13:89442393-89442415 AAGAATATTTATAAAAGTGAGGG + Intergenic
1111574971 13:90142102-90142124 AAAAACATTAATAAAAATGAGGG + Intergenic
1111716151 13:91881549-91881571 ATGCACATTCAGAAAAAAGAAGG - Intronic
1111752473 13:92351370-92351392 ATGCATATTTATTAAAAATATGG + Intronic
1111789941 13:92842077-92842099 ATGTATATTAATAATAATCTAGG - Intronic
1111883328 13:93986355-93986377 AAGGATATTAACAAAAATTAAGG + Intronic
1111912381 13:94327149-94327171 ATGCATAATTTTAAAAATAAGGG + Intronic
1111923480 13:94437725-94437747 ATGCATTTTAACAAATATTAAGG - Intronic
1112038675 13:95523140-95523162 AAGCAAATTAATACAAAAGACGG - Intronic
1112274199 13:98001176-98001198 ATTCATAGAAATAAAAAGGAAGG - Intronic
1112834760 13:103500768-103500790 ATTCATTTTAAGGAAAATGATGG + Intergenic
1113111305 13:106827182-106827204 AGGCATATTTATAACAATAAAGG + Intergenic
1113609777 13:111636039-111636061 ATTCATATTTTTAAAAATGGGGG + Intronic
1114956436 14:27826124-27826146 AAGTTTATTAATAAAATTGAAGG - Intergenic
1114964302 14:27938915-27938937 ATGCCAATTAATCAAAATGCAGG - Intergenic
1115236663 14:31214443-31214465 ATGGATATTATAAAAACTGAAGG + Intergenic
1115260447 14:31447298-31447320 ATGCATATTATTAAAAGAAATGG + Exonic
1115646933 14:35374903-35374925 ATGAATATTAATAAAAAACTAGG - Intergenic
1116251550 14:42490477-42490499 AAGCGTATTAATAAAAATAATGG + Intergenic
1116469114 14:45267054-45267076 ATGAATGGTAATAAAAATAAAGG + Intergenic
1116893017 14:50287273-50287295 ATGCATAATATAAAAAATCATGG + Intronic
1117241065 14:53833790-53833812 ATCTATATTCATAAAAATGTTGG - Intergenic
1117762114 14:59040009-59040031 AGGTATGTTAATAAATATGAGGG + Intergenic
1118664707 14:68055166-68055188 TTTCACATTCATAAAAATGAAGG + Intronic
1119070743 14:71581199-71581221 CTGCTTTTTAATAAAAATAATGG + Intronic
1119366406 14:74095529-74095551 ATGCAGAAAAATAAAAATCAGGG - Intronic
1120859543 14:89242309-89242331 ATGCATATATATATATATGAGGG - Intronic
1123884696 15:24714156-24714178 TTGCATATTAATGAAATTGTTGG + Intergenic
1124581612 15:30960706-30960728 AGGCTTATTAATATAAATTACGG - Intronic
1125264855 15:37867196-37867218 AGGCATATTAAAAATAATGAAGG - Intergenic
1125302698 15:38273493-38273515 ATACATAAAAATAAAAATTAAGG - Intronic
1126418575 15:48446154-48446176 AAGCATTTTAATAAAAGTAATGG + Intronic
1126743520 15:51801670-51801692 ATGCATATTAAAGAAACAGATGG + Intronic
1126923167 15:53550525-53550547 ATGCATAATAAATAAAAGGATGG - Intronic
1127062141 15:55197463-55197485 ATGCATATTAATTAAAATGGGGG - Intergenic
1127147964 15:56044334-56044356 TTGCATATTTAGAAATATGAGGG + Intergenic
1127594686 15:60467951-60467973 TTCCATTTTAAAAAAAATGACGG + Intronic
1128449245 15:67792930-67792952 ATCCATATTAAACACAATGAAGG - Intronic
1129635000 15:77306203-77306225 AAGTATATTAAGAAAGATGATGG + Intronic
1129656552 15:77528657-77528679 CTGCAGATTCATAAAAATCAGGG - Intergenic
1130104247 15:80917620-80917642 TTGCCTATTACTAAAGATGAAGG + Intronic
1130394316 15:83488870-83488892 ATGAAAACTAATAAAAATGGAGG - Intronic
1131300283 15:91193564-91193586 ATGCATTTTAAAAAATTTGAAGG + Intronic
1131474506 15:92726125-92726147 ATGCATACTAAAATATATGAGGG + Intronic
1131749691 15:95493315-95493337 CTGCATTTGAAAAAAAATGAGGG + Intergenic
1131880993 15:96861977-96861999 ATGCATTTAAATGAAAAAGAAGG + Intergenic
1131905558 15:97138162-97138184 ATGAATAAAAATAAAAATGGTGG + Intergenic
1131909526 15:97182093-97182115 ATGAAGTTTAAAAAAAATGATGG + Intergenic
1133957842 16:10461503-10461525 TTGCAAATGAATGAAAATGAAGG + Intronic
1136010610 16:27361141-27361163 CTGTATATTAAAAAAAAGGAGGG - Intronic
1137845670 16:51685469-51685491 GTGTACATCAATAAAAATGAGGG - Intergenic
1138243494 16:55447796-55447818 ATGCACGTTAATAATTATGAGGG - Intronic
1138342772 16:56301559-56301581 ATGCACATACATAAAAATAATGG - Intronic
1140341260 16:74165752-74165774 ATGCATTTTAATAAAGAAGTAGG - Intergenic
1140615850 16:76662510-76662532 ATGTATTTTAATAAAATTTAGGG - Intergenic
1140996787 16:80267987-80268009 TTGCATATATATAAAAATTAAGG + Intergenic
1141056510 16:80820255-80820277 AAGAATATTGATAAAAATTAAGG + Intergenic
1143826621 17:9613980-9614002 GTGCTTATTAAAAAAAAAGAGGG - Intronic
1143991666 17:10968767-10968789 AAACATTGTAATAAAAATGATGG + Intergenic
1144108787 17:12011377-12011399 AAAAATAATAATAAAAATGATGG - Intergenic
1144320361 17:14111654-14111676 AGACATATTAATGAAAATGATGG - Intronic
1144973387 17:19126071-19126093 GTCCATATTAATATAAATGAAGG + Intergenic
1145354386 17:22127371-22127393 ATGCATATTAAAAAATAAAAAGG - Intergenic
1146131168 17:30276792-30276814 ATGTATATTGATATGAATGATGG - Intronic
1147027132 17:37596587-37596609 ATGCATATTAAAAAACAGTATGG + Intronic
1147415206 17:40284088-40284110 AACCATATTAATAACAATGATGG - Exonic
1149156669 17:53639120-53639142 ATTCAAATTTATAAAAATAATGG + Intergenic
1149800697 17:59565106-59565128 ATGCAAATAAATTAAAATGCAGG + Intergenic
1150145874 17:62768840-62768862 CTGCATATTAGAAAATATGATGG - Intronic
1152300732 17:79494120-79494142 ATAAATAGTAATTAAAATGAGGG + Intronic
1153038410 18:787018-787040 ATGAATATTGATAGAAAAGATGG + Intronic
1153400060 18:4674728-4674750 AACCATATGGATAAAAATGAAGG + Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1155433821 18:25790543-25790565 ATGCATAAGAATAACAATGTTGG + Intergenic
1155494312 18:26427662-26427684 ATACAAATTAATAATAATAATGG + Intergenic
1155657946 18:28213004-28213026 AGGAATATTAATAATTATGAAGG - Intergenic
1155658051 18:28214107-28214129 ATGAATATTGATAAAAATATTGG + Intergenic
1155869168 18:31004478-31004500 ATGAAAATAAATAAAAATGGAGG + Intronic
1156054956 18:32991323-32991345 ATGCACACTAATGAAAATAAGGG + Intronic
1156058389 18:33040267-33040289 ATGCATATATATAAAACTAAGGG + Intronic
1156364407 18:36412441-36412463 ATGCATATAATTTAAAATCAGGG + Intronic
1156427787 18:37034180-37034202 GTGCATAGTAATAAAACTTATGG + Intronic
1156438429 18:37158613-37158635 ATGGAAATAAATACAAATGAAGG + Intronic
1156809233 18:41226162-41226184 ATGAATATTAGTAAAAGGGAAGG + Intergenic
1156832435 18:41509322-41509344 ATGCAGATTAAAAAGAATAAAGG + Intergenic
1156875745 18:42008804-42008826 ATTCATTTTCATACAAATGAAGG + Intronic
1158238103 18:55342362-55342384 ATTCATATTAAGATACATGAGGG + Intronic
1158363981 18:56709424-56709446 TTACATAATAATAATAATGATGG + Intronic
1158541421 18:58358664-58358686 AATAATAATAATAAAAATGAAGG - Intronic
1158607213 18:58906281-58906303 ATGCATACTGATATAAATGATGG - Intronic
1158741143 18:60143851-60143873 ATGGATTTTAATAAAATTTAGGG + Intergenic
1159280372 18:66277106-66277128 ATGCTACTTAATAAAAATCAAGG + Intergenic
1159436710 18:68427359-68427381 ATGCATATTAATTAAATTTTAGG + Intergenic
1159538831 18:69749306-69749328 ATGAACATTTAAAAAAATGAAGG + Intronic
1160112060 18:76042520-76042542 ATCCAGAATAATAATAATGATGG - Intergenic
1161527017 19:4762494-4762516 ATGCATATTAACAAAATTCTGGG - Intergenic
1162258984 19:9517278-9517300 ATATATATAAATAAAAATAAAGG + Intergenic
1163094738 19:15048871-15048893 AATAATAATAATAAAAATGATGG - Intergenic
1163240258 19:16058327-16058349 CTGCATCTCAAAAAAAATGAGGG + Intergenic
1166579040 19:43876326-43876348 ATAAATATAAATAAAAATTAGGG + Intronic
1167811675 19:51838233-51838255 GTGCATATTTCTAAAAATCAAGG + Intergenic
1168198508 19:54794606-54794628 ATGGCTATTACTAAAAATGCTGG - Intronic
1168537030 19:57179669-57179691 ATGCTTATTGAGTAAAATGAAGG + Intergenic
925721046 2:6827655-6827677 ATGCATGTTAATAAAAATTTTGG + Intergenic
926494851 2:13573454-13573476 TTGCATTTCAATAAAAAGGAAGG - Intergenic
926531246 2:14048855-14048877 ATACATATAAATACAAAGGAGGG + Intergenic
926906720 2:17812584-17812606 ATGCAGATTTAAAGAAATGATGG + Intergenic
927168487 2:20349425-20349447 ATCATTATGAATAAAAATGATGG - Intronic
927302485 2:21531478-21531500 ATTCATATTAATAAAATAAAGGG - Intergenic
927731767 2:25479792-25479814 ATGCACAGTGATAAAAATGCAGG - Intronic
928056353 2:28059295-28059317 ATGGATCTTCAGAAAAATGAAGG - Intronic
928503344 2:31921644-31921666 ATGCATTTTTATTAAAATCATGG - Intronic
928579686 2:32695120-32695142 CTGCATATTGATAATACTGATGG - Intronic
928683275 2:33724971-33724993 ATTGATATTAAAAAAAATTATGG + Intergenic
928713422 2:34033108-34033130 AAGCATATTTTTAAAAATGTGGG + Intergenic
929020649 2:37549128-37549150 ATGCATAGTTAAAAAAATAAAGG - Intergenic
929208268 2:39322967-39322989 ATGCATACTCTTAAAAATAAGGG - Intronic
929298714 2:40277029-40277051 ATGTAAATTAAAAACAATGATGG + Intronic
929616273 2:43311338-43311360 ATGGCTATTAATAAAACAGATGG + Intronic
929727056 2:44440821-44440843 ATGGATAATAAAAAAAATAAGGG - Intronic
929770751 2:44889633-44889655 ATGGATATTAATAAGAATACTGG + Intergenic
929837759 2:45423100-45423122 GTGCAAAACAATAAAAATGACGG + Intronic
930376949 2:50579758-50579780 ATGCATATTTATGAAAAAGCTGG - Intronic
930377028 2:50580855-50580877 ATACATACTAATGAAAATAATGG + Intronic
930466010 2:51750738-51750760 ATAAATATTAATAATAATAAAGG - Intergenic
931011527 2:57920914-57920936 TTGCATACAAATATAAATGAAGG - Intronic
931573429 2:63695115-63695137 ATTCATATCAATGAAAATAAGGG - Intronic
931951642 2:67370132-67370154 ATCCATAGTAATCAATATGATGG - Intergenic
932691186 2:73915015-73915037 ATGTATTTTAAAAAAAATTAGGG + Intronic
933427814 2:82135455-82135477 ATGCACATTAATAAATAAAATGG - Intergenic
933541953 2:83655752-83655774 ATGCACATCAATACAAAAGAAGG + Intergenic
934168343 2:89317635-89317657 ATGCATTTTATTAAAATTGATGG - Intergenic
934198944 2:89864947-89864969 ATGCATTTTATTAAAATTGATGG + Intergenic
934480849 2:94641876-94641898 AAGTTTATTAATAAAATTGAAGG + Intergenic
935651916 2:105389627-105389649 ACGCATATTTATGAAAAAGAGGG + Intronic
935688419 2:105708223-105708245 TTGTATCTTAATCAAAATGAAGG + Intergenic
935785198 2:106542473-106542495 ATGCACATTAATGAAAATCCAGG - Intergenic
935859734 2:107315982-107316004 ATTCATAGTAATAAAAAAAATGG + Intergenic
936654179 2:114465383-114465405 ATGCATTGCAATAGAAATGATGG - Intronic
936857385 2:116975857-116975879 ATTCATCTTACTAGAAATGATGG - Intergenic
937245922 2:120493064-120493086 ATGGATATTAATTAACATTAAGG - Intergenic
937509485 2:122578012-122578034 AGGCATATTCAGAAAACTGATGG - Intergenic
937546196 2:123023989-123024011 ATGTTTAATAATAAAAATAAGGG + Intergenic
937617388 2:123941799-123941821 ATGCAAATTGGTAAAAATAAGGG + Intergenic
939200958 2:139033323-139033345 ATCCATTTTTGTAAAAATGAAGG - Intergenic
940184480 2:150968365-150968387 ATGAAAAGTGATAAAAATGAGGG + Intergenic
940586354 2:155656856-155656878 AGGCATATTAAAAAAATTTAAGG + Intergenic
940607112 2:155939796-155939818 ATGTTTATTAGTAAAAATAAAGG - Intergenic
940881964 2:158955476-158955498 ATGTATATTAACAAAGATCAGGG - Intergenic
940921111 2:159307729-159307751 GTGCTGATAAATAAAAATGATGG + Intergenic
941361677 2:164559255-164559277 ATAAATATTTAGAAAAATGAAGG - Intronic
941648220 2:168064852-168064874 ATGCATATTTATTAAAGTTATGG - Intronic
941777178 2:169405906-169405928 ATACATATAAATCAAAATGGAGG + Intergenic
941792085 2:169563611-169563633 TTGCATATTAACAAATATAATGG + Intronic
941805612 2:169709180-169709202 ATGTATATATTTAAAAATGAAGG - Intronic
941967778 2:171316711-171316733 ATAAATATTAAAATAAATGAGGG + Intergenic
942452222 2:176115628-176115650 ATACATATTAAGAAGAATCAGGG - Intronic
943662819 2:190577473-190577495 ATAAATATTAAGAAAAATGAGGG - Intergenic
943894426 2:193336222-193336244 ATGCATATTATTAGAAAGAAGGG - Intergenic
944362264 2:198870913-198870935 ATGCACATTATTAAAACTAAAGG + Intergenic
944572150 2:201055707-201055729 AAACATAAAAATAAAAATGAAGG + Intronic
944605168 2:201346197-201346219 ATGCAAATTAAGTAAAGTGAGGG - Intronic
944885617 2:204059603-204059625 TTGCATTTTAATAAAAATTTGGG + Intergenic
945034473 2:205692577-205692599 CTGCATATTTATAAATATTATGG - Intronic
945250968 2:207766727-207766749 ATACATATAAATTAAAAAGAGGG + Exonic
945783923 2:214210045-214210067 AAGCAGATTAAGAAAAATGTAGG - Intronic
946656747 2:221956712-221956734 CTGCATTTTAATAAAATTAAGGG - Intergenic
946824893 2:223667694-223667716 AAACAAATAAATAAAAATGAAGG + Intergenic
947057243 2:226119234-226119256 ATGCTTTTTAATTAAAATGTAGG - Intergenic
948969812 2:241416484-241416506 ATGTATAATAATTAAAATAAAGG - Intronic
1168856352 20:1011943-1011965 ATGAATACAAATAATAATGATGG - Intergenic
1169581110 20:7024022-7024044 AGGCATATTATTGAAAGTGATGG - Intergenic
1169598057 20:7223342-7223364 ATACATAGTAATGAAATTGATGG + Intergenic
1170003408 20:11640014-11640036 TTACATATCAATAAAAAAGAAGG + Intergenic
1170061472 20:12264082-12264104 ATGTATAATAATAATAATGCAGG + Intergenic
1170688473 20:18589846-18589868 CTGCATATTAAAAAAGATAAGGG + Intronic
1172171980 20:32941880-32941902 TTAGATATTACTAAAAATGATGG + Intronic
1173377608 20:42501793-42501815 ATGCATATTAAAACATATCATGG - Intronic
1174620873 20:51873646-51873668 AGGCAGATTAAGAAAGATGAAGG - Intergenic
1175086371 20:56462548-56462570 ATGCAGTATATTAAAAATGAGGG - Intergenic
1176905788 21:14499234-14499256 ATACATATTGATTCAAATGACGG - Intronic
1177200242 21:17945676-17945698 AAGCATATTTAATAAAATGATGG + Intronic
1177267545 21:18804144-18804166 ATGCACATTAATAGAACTGTGGG + Intergenic
1177688370 21:24469911-24469933 GTGCATTTTGCTAAAAATGATGG + Intergenic
1178087173 21:29123487-29123509 AAGCATATTAAAAAACATTATGG + Intronic
1178174333 21:30078777-30078799 AAGTATATTGATAAAAATGAAGG + Intergenic
1178181909 21:30171184-30171206 ATACATATTATTAAAAATTAAGG + Intergenic
1178803909 21:35822797-35822819 ATGAATCTTATTAAAAATCAAGG + Intronic
1179144441 21:38754978-38755000 ATGCATACATATAAAAATGGTGG + Intergenic
1179377656 21:40865237-40865259 ATGCATATGAATAAAGACAAAGG - Intergenic
1181292599 22:21808515-21808537 ATTCAAATTCATAAAATTGAAGG - Intronic
1181451578 22:23026257-23026279 ATGCAAATTAATAAGGAAGAAGG + Intergenic
1183053372 22:35283875-35283897 ATCCATAGTAATAAAATAGAAGG - Intronic
949262871 3:2122372-2122394 ATGCTTACTATAAAAAATGATGG + Intronic
949429081 3:3953577-3953599 ATGCAAAATAATAAATATGATGG - Intronic
949459057 3:4270780-4270802 ATTGATATTAACAAAGATGAAGG + Intronic
949551340 3:5114731-5114753 ATACATTTTATTAAAAATAAAGG - Intergenic
949747265 3:7309614-7309636 ATGCATACTCAGAAAAATGCCGG - Intronic
950276908 3:11669418-11669440 ATGAATATCATTAAAAAAGAAGG - Intronic
950724738 3:14909421-14909443 AACCATATTCATAAAAAAGAAGG + Intronic
950783264 3:15410700-15410722 ATGCTCATTAAAAAAAATTAAGG + Intronic
950815202 3:15693980-15694002 AAGCATTTTACTAAAAATCATGG + Intronic
951011586 3:17688010-17688032 CTGCAAATTAATGAAAATGAAGG + Intronic
951378516 3:21953709-21953731 ATGAATATTAAAAAAATGGATGG - Intronic
952065498 3:29564625-29564647 TTACATAATAATAAAAATAAAGG - Intronic
952172419 3:30822567-30822589 ATGCATATTAATATATATCTAGG - Intronic
952731723 3:36643720-36643742 ATGCATAATAAACAAAATTATGG - Intergenic
952777434 3:37060034-37060056 ATGCACATAAATAGGAATGATGG - Intronic
954965144 3:54603850-54603872 ATGCATATCTAATAAAATGATGG - Intronic
955444321 3:58993191-58993213 AAGCATTCTATTAAAAATGAAGG - Intronic
955667965 3:61370220-61370242 ATGAGTATTAAGAAAAATCAGGG - Intergenic
955669337 3:61386291-61386313 ATGTATATTTATAAAAGTCAGGG - Intergenic
955722288 3:61895370-61895392 AAGCATTTTAATAACCATGAAGG - Intronic
955871471 3:63442837-63442859 ATGCATTTACATTAAAATGAGGG + Intronic
956361340 3:68451373-68451395 GAGCATATTAATAAGACTGAAGG + Intronic
956546062 3:70404505-70404527 AAGCATAAGAATAAAAATTATGG + Intergenic
956974382 3:74563432-74563454 TTACATATTAATAATAATAATGG - Intergenic
957274665 3:78075419-78075441 AGGTATAATAATAATAATGAGGG - Intergenic
957387500 3:79516094-79516116 ATGCATATGAAGAAAAAAAAAGG + Intronic
957525529 3:81374401-81374423 ATTCATATGAATCAAAATGCAGG + Intergenic
958036749 3:88178861-88178883 ATGCTTATTAGTGAAAATGCTGG - Intergenic
958061873 3:88494266-88494288 ATAAATAATAATAAAAATAAAGG - Intergenic
958097243 3:88962454-88962476 ATTCATTTTAATAAATATCAGGG + Intergenic
958177361 3:90013371-90013393 GTCCAAATTAACAAAAATGAGGG - Intergenic
958252745 3:91289322-91289344 ATGCAAAATAATAAAATTGGGGG - Intergenic
958595091 3:96212292-96212314 ATGAATATAAATATTAATGATGG + Intergenic
959281340 3:104345493-104345515 ATGCGCTTTAATAATAATGACGG - Intergenic
959346616 3:105203188-105203210 GAGAATGTTAATAAAAATGATGG - Intergenic
959822159 3:110748984-110749006 TTGGATAGTAATAAAATTGATGG + Intergenic
960294094 3:115921754-115921776 TTGCATATAAACAAAAATTAAGG - Intronic
960464891 3:117985596-117985618 ATACATATTAAAAAAAAATAAGG + Intergenic
960823934 3:121762584-121762606 AGGCTGATTAATACAAATGAAGG + Intergenic
961209808 3:125116941-125116963 ATGCATGTAGATACAAATGAGGG + Intronic
962165599 3:133044619-133044641 AGGCATCTTGATAAAAATGCAGG - Intronic
964083804 3:152791411-152791433 ATGCATATAAATAAATTTTAGGG + Intergenic
964710259 3:159664588-159664610 ATGCCAATTAGTAAAAATTATGG + Intronic
965698165 3:171430927-171430949 ATGCAAATTGATTAAAATTAAGG - Intronic
965879779 3:173374683-173374705 ATGCATACTAATAACAAAGATGG - Intergenic
965951302 3:174311182-174311204 AAGCATATTTATAAATATGAAGG - Intergenic
966022696 3:175235510-175235532 CTGTATATTAATAAAAATAGAGG + Intronic
966033506 3:175379724-175379746 AGGAATATTTACAAAAATGAGGG - Intronic
966581427 3:181570036-181570058 TTCAATATTAATCAAAATGAGGG - Intergenic
966999237 3:185316203-185316225 AAGGATATTAATAAAAATGTTGG - Intronic
968413291 4:407242-407264 ATGCATATTAAGAATAAGGCGGG + Intergenic
968684815 4:1950793-1950815 AGGCATATTCCTTAAAATGAAGG - Intronic
968743803 4:2346832-2346854 AAGCCAATTAATAAAAAAGAAGG + Intronic
969788550 4:9476054-9476076 ATTAATATTAATATAAATAATGG - Intergenic
970025939 4:11624310-11624332 ATTCAAAATAATAAAATTGAGGG + Intergenic
970060864 4:12032592-12032614 TTTCATATTAAGAAAAGTGATGG + Intergenic
970509432 4:16766219-16766241 ATGTATATTAATATAAAAGATGG - Intronic
970677527 4:18468702-18468724 AGGGAAATTAATAAAAGTGAAGG + Intergenic
970808185 4:20060568-20060590 ATGATGAATAATAAAAATGAAGG - Intergenic
970848933 4:20578474-20578496 ATTAATATTGATAATAATGAAGG - Intronic
970947541 4:21712832-21712854 ATGCTTAGAAATAAAAAGGAGGG - Intronic
970981100 4:22098366-22098388 ATGAATATAAAGAAAAATTAAGG + Intergenic
971074373 4:23130685-23130707 ATGTAAATTAATTAAAATTAAGG + Intergenic
971539255 4:27795263-27795285 ATGCATATTATTTCAAATGAGGG + Intergenic
971562496 4:28099086-28099108 ATTCATTTTAAACAAAATGATGG - Intergenic
971673275 4:29592115-29592137 AAACATATAAATAAGAATGAGGG + Intergenic
971897392 4:32615488-32615510 AGGCAAATTAATAAATATAAAGG + Intergenic
971957291 4:33437999-33438021 ATGAATATTAATCAGAATGTTGG + Intergenic
972398486 4:38677848-38677870 GTGCATATGGATATAAATGAGGG + Intronic
972698016 4:41466729-41466751 AAACATAATAATAATAATGAAGG - Intronic
972836283 4:42874160-42874182 AAGCATATTGCTAAAACTGAAGG - Intergenic
972908002 4:43774963-43774985 ATGAAGATTAAAAAAATTGAGGG - Intergenic
972969578 4:44556268-44556290 ATTAATATTAATAATAATCATGG - Intergenic
972969949 4:44561711-44561733 ATTTATATCAATAAAAATGAAGG + Intergenic
973156802 4:46965266-46965288 GTGCTTTTTAATACAAATGATGG - Intronic
974336163 4:60547731-60547753 AAGCATATTAGAGAAAATGATGG - Intergenic
974392554 4:61290912-61290934 ATGCAAAATATTAAAAATGAAGG + Intronic
974588224 4:63909488-63909510 ATGCATCTTATGTAAAATGAGGG + Intergenic
974654086 4:64797163-64797185 ATGCATATGCGTGAAAATGAGGG + Intergenic
974668903 4:65002583-65002605 ATGTATATTAATTTAAATAAAGG + Intergenic
974826487 4:67137424-67137446 AGGTATATTAATAAAAATCTTGG + Intergenic
975168335 4:71203542-71203564 ATGCATGCTAACAAAAAAGAGGG - Intronic
975213521 4:71728470-71728492 ATGCATAAGAATACAAATGGAGG + Intergenic
975469240 4:74746087-74746109 ATTCAGACTAACAAAAATGATGG + Exonic
976008585 4:80459934-80459956 TTGCATATTAATAAATTTTATGG - Intronic
976160785 4:82196536-82196558 ATGCATTTTAATAGGAATGTCGG + Intergenic
976216127 4:82717178-82717200 CTGCCTAGTAATAAAAATAATGG - Intronic
976562997 4:86523145-86523167 ATACCTATTAATAAACATAAAGG - Intronic
976838094 4:89398871-89398893 ATGCATATTAATAGAAGGGTAGG + Intergenic
976911508 4:90312832-90312854 AGGAAAATAAATAAAAATGAAGG - Intronic
976961170 4:90976692-90976714 CTGTAAATAAATAAAAATGAAGG + Intronic
977201075 4:94117226-94117248 AAGCAGATTAAAAAAAATAAAGG - Intergenic
977293153 4:95184775-95184797 ATGAAAATTAATTGAAATGATGG + Intronic
977432335 4:96945922-96945944 ATACATATTTAAGAAAATGATGG + Intergenic
977577339 4:98689517-98689539 ATGCATATAAAAAAAATTGTTGG + Intergenic
977759969 4:100722207-100722229 ATTCATAGTCATAGAAATGATGG - Intronic
977840605 4:101698623-101698645 ATTAATTTTAATAAAAATGGAGG + Intronic
977965072 4:103136115-103136137 AAGGATATTACTAAAAAAGATGG + Intronic
978510420 4:109511813-109511835 AAGCATATTAATAAAATCCAGGG - Intronic
978731387 4:112030875-112030897 AACCATAATAATAAAAATGGGGG + Intergenic
978881374 4:113707267-113707289 ATGCAGAGAAATAAAAAGGAAGG + Intronic
978889769 4:113810688-113810710 ATTTAAATTAAGAAAAATGATGG - Intergenic
979692995 4:123580500-123580522 CTACATATTAAGAAAAAAGATGG - Intergenic
980002707 4:127508983-127509005 AAGCATTTAAAAAAAAATGATGG - Intergenic
980088771 4:128419475-128419497 ATGCTAATTAATAAAAAGTAAGG - Intergenic
980294819 4:130898666-130898688 ATGCATTATAATAAAAATCATGG + Intergenic
980342964 4:131575010-131575032 CTGCAGAATAATAATAATGATGG + Intergenic
980367707 4:131827247-131827269 ATGCATATGGATAAAAATAAAGG + Intergenic
980445505 4:132901566-132901588 ATGCATATTAATATTAATAGAGG - Intergenic
980470748 4:133248672-133248694 ATGCATATGAAAAAAAAATAAGG + Intergenic
980792737 4:137640137-137640159 ATGCCTTCTAATAAAAATAATGG + Intergenic
981259084 4:142698241-142698263 TTTCAAATCAATAAAAATGATGG - Intronic
981392701 4:144210322-144210344 TGACATATTAATAAAAAAGATGG - Intergenic
981662014 4:147178495-147178517 ATGCATTTTAAGAAAATTGCAGG - Intergenic
981799886 4:148643246-148643268 ATGTTTGTTAATTAAAATGAAGG + Intergenic
981898139 4:149829073-149829095 ATCGATATAAATAGAAATGACGG - Intergenic
982038616 4:151372558-151372580 ATGCATATTATTATGAAAGAAGG + Intergenic
982043240 4:151415675-151415697 GTTCATATAACTAAAAATGAAGG - Intronic
982155816 4:152519634-152519656 ATGCAAATCAATTCAAATGACGG + Intronic
982160374 4:152562958-152562980 AAGCATCTCAATAAAACTGAAGG + Intergenic
982951801 4:161707551-161707573 AAGCTTACTAATGAAAATGAAGG + Intronic
983002700 4:162438078-162438100 ATGTATAAAAATAAAAATAAAGG - Intergenic
983004960 4:162472911-162472933 ATATATGTTAATTAAAATGATGG + Intergenic
983111188 4:163751436-163751458 CTACATATTAAAAAAAATGGTGG - Intronic
983719637 4:170833587-170833609 AAGCATATTAACAAAAATAGGGG + Intergenic
983728697 4:170965680-170965702 ATGCTTAGTAACAATAATGAGGG - Intergenic
983812922 4:172086680-172086702 ATGCATATTATTTGAAATAATGG - Intronic
984145910 4:176060631-176060653 ATGTATAGTAATAAAAAGCATGG - Intergenic
984212050 4:176861795-176861817 ATGCATTTAAATAAAGAAGAAGG + Intergenic
984362447 4:178753077-178753099 ATGTAGATTAATAAAAAGGGGGG - Intergenic
984540069 4:181026737-181026759 AAGCATCTTAATAAATATTAAGG + Intergenic
984601968 4:181738050-181738072 ATGAACATTAACATAAATGATGG + Intergenic
985339137 4:188929943-188929965 ATGCATATTTATAAAGTTGTAGG - Intergenic
986642450 5:9885962-9885984 AAGGATATTAAGAAAACTGAGGG + Intergenic
987234671 5:15930705-15930727 ATACATAGAGATAAAAATGAGGG + Intronic
987437778 5:17917897-17917919 TTGCATAATAATAATAATTAAGG + Intergenic
987944874 5:24593159-24593181 AATCAGATTTATAAAAATGATGG + Intronic
988350423 5:30098582-30098604 ATGAAAATTAATAAATATGTAGG + Intergenic
988390913 5:30628983-30629005 AAGCATCTTAATAATTATGATGG - Intergenic
988559940 5:32271988-32272010 TTGGATATTAAGAAAAATGGGGG + Intronic
989016970 5:36947872-36947894 ACACATTTTCATAAAAATGATGG - Intronic
989436925 5:41424666-41424688 ATACAGAAAAATAAAAATGAAGG - Intronic
989520503 5:42395640-42395662 AGGAATATTAACAAAAATGAAGG - Intergenic
990016565 5:51069558-51069580 CACCATATTAACAAAAATGAAGG - Intergenic
990236119 5:53769889-53769911 AAGAATATTAAAAGAAATGAAGG + Intergenic
990433653 5:55765146-55765168 ATGGAAAAGAATAAAAATGATGG - Intronic
990645510 5:57839294-57839316 ATGAATATAAATAAATATGTGGG + Intergenic
990649393 5:57881162-57881184 ATACATATTAATAAAAATTCTGG - Intergenic
990857522 5:60286627-60286649 AAACATATGAATAAAAATGAAGG - Intronic
991226915 5:64284371-64284393 ATTCATATTCACAAAAATGCAGG - Intronic
991231376 5:64336645-64336667 ATGAATGTAAATTAAAATGAGGG - Intronic
991423128 5:66461984-66462006 AGTTATATTAAAAAAAATGAAGG + Intergenic
991595314 5:68298507-68298529 ATGAATATTAACAAAAATCCGGG - Exonic
992197170 5:74351369-74351391 ATGTAAATTAATAAGAATGATGG - Intergenic
992585847 5:78239043-78239065 AAACATATTAACAAAAATAAAGG + Intronic
992764065 5:79978610-79978632 ATCCATATTAAAATAAATTAGGG + Intronic
992823685 5:80525981-80526003 ATGCATATACATATATATGAAGG + Intronic
992860646 5:80906074-80906096 ATGAATATTGAAAAAAATAAAGG + Intergenic
992933847 5:81680259-81680281 ATGCATATTTATTATTATGAGGG - Intronic
993114233 5:83700546-83700568 ATACATAGTAATATAAATTAAGG + Intronic
993640065 5:90391851-90391873 ATGTATATTAACAAAAAAGACGG + Intergenic
993942664 5:94079222-94079244 ATGCATTTTAATAAGATTAAAGG - Intronic
994783527 5:104124536-104124558 AAGCAGAATAATAAAATTGAAGG + Intergenic
994972052 5:106752930-106752952 ATTCATATTAAAAACATTGATGG + Intergenic
995122226 5:108548257-108548279 AGGCATTAGAATAAAAATGAAGG - Intergenic
995533276 5:113111532-113111554 AGGCAGATTAATAAAAATAAGGG - Intronic
995958767 5:117813390-117813412 ATTGATATTAAAAAAAATAATGG + Intergenic
996445996 5:123551369-123551391 ATACATATTTTTAAAAATTACGG - Intronic
996491884 5:124107500-124107522 AATTATATTAATCAAAATGAAGG - Intergenic
996994161 5:129674687-129674709 ATGCATAATAGCAAAAAGGAAGG - Intronic
997045855 5:130316802-130316824 AAACATATTAATCAAAATGTAGG + Intergenic
997997085 5:138595673-138595695 AGGGAAATGAATAAAAATGATGG + Intergenic
998564996 5:143209078-143209100 CTCCATTTTGATAAAAATGAAGG - Intronic
998576421 5:143322693-143322715 ATTCATATCAATATAAAGGAAGG + Intronic
1000473010 5:161669936-161669958 AAGCAAATTAATAAATATGAAGG + Intronic
1000857337 5:166415507-166415529 AAGCATGTTAATAAATATGAAGG - Intergenic
1000902683 5:166928845-166928867 AAACATAGTAATAGAAATGAAGG + Intergenic
1001076150 5:168629475-168629497 ATGCATAGAAATACAACTGAAGG + Intergenic
1001222859 5:169917659-169917681 ATGCATAGAAAGAGAAATGAAGG + Intronic
1001345267 5:170890438-170890460 TTTAATATTAATAAAAATTAAGG + Intronic
1001350286 5:170956295-170956317 ATATTTAATAATAAAAATGAAGG - Intronic
1002308025 5:178295413-178295435 ATTCATAATAAAAGAAATGAAGG + Intronic
1002514649 5:179748530-179748552 AGGCATATCAATAAAATTTAAGG + Intronic
1002963952 6:1943669-1943691 TTGCATACTAATAAGAATAAAGG + Intronic
1003055606 6:2816293-2816315 AAGCACAATAAAAAAAATGAAGG - Intergenic
1003230688 6:4250586-4250608 ATCCAAATTAATAAAATTCAAGG + Intergenic
1003306866 6:4936978-4937000 TTGCAAATTAATTAAAATCATGG + Intronic
1003476684 6:6490207-6490229 ATCCATATTACTCAAAATGTGGG - Intergenic
1003726237 6:8768088-8768110 AAACAAACTAATAAAAATGAGGG - Intergenic
1003805125 6:9719253-9719275 ATGGTTATTAATAATAATGGTGG - Intronic
1004370127 6:15045009-15045031 ATGCAGGTTAATAAAAGAGAAGG - Intergenic
1004602063 6:17159848-17159870 ATTCATCTTAATAAAAAAGAAGG + Intergenic
1004638362 6:17490094-17490116 ATGCATATTAATATAGACTATGG - Intronic
1005096591 6:22123249-22123271 TCACATATTAATAAAAGTGATGG + Intergenic
1005309601 6:24546953-24546975 ATGCTTGTTAATAGAAATAAAGG - Exonic
1005326315 6:24704253-24704275 TGGCAAAATAATAAAAATGAGGG + Exonic
1005468037 6:26134565-26134587 ATGCATATTAATACAACAAAGGG + Intronic
1006241683 6:32686235-32686257 ATAGCTATTGATAAAAATGAGGG + Intergenic
1006663428 6:35670162-35670184 ATGCAATTTATAAAAAATGAAGG + Intronic
1007208387 6:40171245-40171267 TTGCAGATTTATAAAGATGATGG + Intergenic
1007649805 6:43412508-43412530 ATGAATATTTGTAATAATGATGG + Intergenic
1008183346 6:48361369-48361391 ATGCTTATTCATAAAGATGTAGG - Intergenic
1008227565 6:48939398-48939420 ATTAATGTTAATAAAAATGATGG + Intergenic
1008233775 6:49018636-49018658 CTGCATCTTAATACAAATGTGGG + Intergenic
1008422516 6:51318455-51318477 AGGCATTGAAATAAAAATGATGG + Intergenic
1008599384 6:53075544-53075566 ATGGCTATTAATAAAATTAAAGG - Intronic
1009191734 6:60637596-60637618 ATGCAAAATAATAAAATTGGGGG + Intergenic
1009200506 6:60739118-60739140 ATGCATATTAATGTTAATTAAGG - Intergenic
1009533143 6:64845957-64845979 ATGATTTTAAATAAAAATGAAGG - Intronic
1009668710 6:66717070-66717092 ATGCATAAGAATGAAAGTGATGG - Intergenic
1009807216 6:68615799-68615821 ATGAAAATCAATAAAAATGTAGG + Intergenic
1010103310 6:72136924-72136946 AACTATATTAATAAAAATCAAGG + Intronic
1010130031 6:72481036-72481058 ATGCATATCACTAATAATCAGGG + Intergenic
1010220584 6:73445198-73445220 ATGAATATTTATTAAATTGATGG - Intronic
1010447389 6:75963276-75963298 ATGCATATTATTTAAAAATATGG + Intronic
1010999128 6:82568097-82568119 ATGAAAATTAATAATAATAATGG - Intergenic
1011541816 6:88438689-88438711 TTGCATACTAATATAAATGTTGG + Intergenic
1012216780 6:96596475-96596497 ATATATATTAATAACAATTAAGG - Intronic
1012287781 6:97414259-97414281 AAACATATTCATAAAAATTAAGG + Intergenic
1012331701 6:97998444-97998466 CTGAATTTTGATAAAAATGAAGG - Intergenic
1012361056 6:98380976-98380998 ATTCATATTAATAAAATTAAAGG + Intergenic
1012907050 6:105079560-105079582 ATGCCTATTAAGAGAAATGAAGG + Exonic
1013132915 6:107252176-107252198 ATGCTGATTAAAATAAATGAGGG + Intronic
1013929044 6:115507819-115507841 TTCAATATTAATAAAAATGTAGG + Intergenic
1014429552 6:121351622-121351644 ATCCCTATTTATACAAATGAGGG + Intergenic
1014641572 6:123917107-123917129 AAGAACACTAATAAAAATGATGG - Intronic
1014821163 6:125989747-125989769 TTTCATCTTAAGAAAAATGAGGG - Intronic
1014843736 6:126250768-126250790 ATACATATTTCTAAAAATGCAGG + Intergenic
1015108179 6:129561474-129561496 ATGAATATTAAAGAAAATGATGG + Intergenic
1015321582 6:131881370-131881392 ATAAATATTAATAAATAGGATGG - Intronic
1015559549 6:134499888-134499910 ATGCAAATTTATATAAATCAAGG + Intergenic
1016277027 6:142366046-142366068 TTACATATTTATATAAATGAAGG - Intronic
1016757475 6:147702525-147702547 AAGCATCCTAATAAAAATTATGG + Intronic
1016856109 6:148671954-148671976 AAGCATATTTATGAAAATAATGG - Intergenic
1017031385 6:150226071-150226093 ATGAATATGAATCAAAATGGGGG - Intronic
1017071878 6:150582357-150582379 ATTCATATTAATAAAGAAGGGGG + Intergenic
1017509627 6:155102497-155102519 ATTATTATTAATAAAAATAAGGG - Intronic
1017513526 6:155135379-155135401 ATGCATTAAAATAAAAATGATGG - Intronic
1020447869 7:8287792-8287814 ATGGATAGTAAGAAGAATGAGGG - Intergenic
1020983918 7:15108730-15108752 AGGTATGTTAATAAAAGTGAAGG - Intergenic
1021013766 7:15506082-15506104 TTGAATGTTAATAAAAATAAGGG - Intronic
1021646047 7:22790410-22790432 ATGCATAGATCTAAAAATGATGG - Intergenic
1021713219 7:23437179-23437201 ATGTATATTAATAAAATTATCGG + Intronic
1021758529 7:23880114-23880136 ATAAATTATAATAAAAATGAAGG + Intergenic
1021965151 7:25910703-25910725 GTGCATACATATAAAAATGATGG + Intergenic
1022751558 7:33232006-33232028 ATGAATATTAACAAAAATTAAGG + Intronic
1023408028 7:39857272-39857294 ATGCAAATTAGTTAAAAGGATGG - Intergenic
1024205070 7:47151272-47151294 TTACTTCTTAATAAAAATGATGG - Intergenic
1024434578 7:49335754-49335776 ATGTATATTAACAAAAATATGGG - Intergenic
1024818490 7:53299121-53299143 ATGCATATTAATAAAATAAATGG - Intergenic
1025027845 7:55532826-55532848 ATGCATATTACTAGAATTGAGGG - Intronic
1025137830 7:56435278-56435300 ATGCAAATTAGTTAAAAGGATGG + Intergenic
1025918951 7:65892091-65892113 ATCCATATTGTTGAAAATGACGG + Intronic
1026769432 7:73185473-73185495 ATACATATGAATAAACATTAAGG - Intergenic
1027010301 7:74738857-74738879 ATACATATGAATAAACATTAAGG - Intronic
1027077741 7:75207180-75207202 ATACATATGAATAAACATTAAGG + Intergenic
1027309667 7:76941970-76941992 ATGTAGAATAATAAAAATCATGG - Intergenic
1027527631 7:79290622-79290644 ATAGATATTAGAAAAAATGAAGG - Intronic
1027837801 7:83267684-83267706 ATGCATTTTAATCAAATCGAAGG - Intergenic
1028361896 7:89978056-89978078 GTTCATATTAATAAGAATTAAGG - Intergenic
1028408063 7:90497948-90497970 ATGAATATTAATAGATCTGAAGG - Intronic
1028524961 7:91773787-91773809 ATGGATACTAAGAAAAAGGAAGG - Intronic
1030116030 7:106062975-106062997 ATGCAGATTAATAAAAGAAAAGG + Intergenic
1030310493 7:108064145-108064167 ATGAATAATAATGAAAATGAAGG - Intronic
1030378209 7:108778848-108778870 TTCCATATTAATAAAATAGAAGG + Intergenic
1031187575 7:118502174-118502196 ATGCATATTTATAAGTATAATGG - Intergenic
1031449612 7:121898528-121898550 CAGTATATTAAAAAAAATGAAGG - Intronic
1031670441 7:124536552-124536574 ATGTAAATAAATAAAAATGAGGG - Intergenic
1032378998 7:131456230-131456252 AATTATAATAATAAAAATGAAGG - Intronic
1032741378 7:134742801-134742823 ATGCTCATTTATAAAAAAGAAGG - Intergenic
1032970694 7:137160692-137160714 AAACATATTAGTAGAAATGAAGG - Intergenic
1032985182 7:137329783-137329805 ATGGATATTCCTGAAAATGATGG - Intronic
1033932066 7:146536345-146536367 ATGAGTATTAATAATAATAAAGG + Intronic
1034504525 7:151476868-151476890 ATTCTTATTAATAAAAATAGTGG + Intronic
1036060998 8:5320900-5320922 ATGCAAATTAAAATAACTGAGGG + Intergenic
1036262559 8:7252353-7252375 ATTCATGTTAATAAAAAACAAGG + Intergenic
1036304027 8:7587205-7587227 ATTCATGTTAATAAAAAACAAGG - Intergenic
1036314598 8:7710892-7710914 ATTCATGTTAATAAAAAACAAGG + Intergenic
1036354882 8:8035197-8035219 ATTCATGTTAATAAAAAACAAGG - Intergenic
1036395257 8:8365114-8365136 AAGCATCTCTATAAAAATGATGG + Intronic
1036724018 8:11202319-11202341 TTGCATATTAAAAAAAAAGTTGG - Intergenic
1037391832 8:18401066-18401088 TTTCAAATTAATAAAAATAAAGG + Exonic
1037727959 8:21498982-21499004 AGGCATATTATGAAAAATAAAGG - Intergenic
1037771481 8:21802793-21802815 ATGCATATACATAGAAATGGAGG + Intronic
1038100770 8:24371872-24371894 ATACATATTAATAGGAATAATGG + Intergenic
1038113572 8:24527532-24527554 ATGCATTTTAATAAGCATAATGG - Intergenic
1038519512 8:28218264-28218286 ATTAATATTAATAAAAACTATGG + Intergenic
1038959001 8:32498122-32498144 ATAAATATTAATAAAATTGTGGG - Intronic
1038970466 8:32627810-32627832 ATGAATTTTAAGAAAATTGAGGG - Intronic
1039000079 8:32970206-32970228 ATAGATATTAATAAAGGTGATGG + Intergenic
1039066828 8:33616299-33616321 CTGCATATTAAAAAAGATTAAGG - Intergenic
1039723648 8:40191779-40191801 AAGCATATCAATAAAAAATATGG - Intergenic
1040757429 8:50795033-50795055 ATGCATATAAATACATATGTAGG - Intergenic
1041148436 8:54905072-54905094 AGACATTTTAATGAAAATGAAGG + Intergenic
1041197525 8:55415910-55415932 ATGATTATCAATAATAATGAGGG - Intronic
1041303098 8:56433761-56433783 ATTCTTATGAAGAAAAATGATGG + Intergenic
1041566132 8:59281066-59281088 ATGCATATATGTTAAAATGAGGG - Intergenic
1041697459 8:60751270-60751292 ATGCATATTAATAAAAATGAAGG - Intronic
1041753673 8:61288920-61288942 AAGAATAAAAATAAAAATGATGG + Intronic
1041816842 8:61982821-61982843 ATTCATATTGATAGAAATGAAGG + Intergenic
1042037020 8:64544377-64544399 TTAGATATTAAGAAAAATGATGG + Intergenic
1042177694 8:66053476-66053498 TTGCAAATTACCAAAAATGAAGG + Intronic
1042593918 8:70425268-70425290 ATGCAGATTAAAAAAAATAAAGG - Intergenic
1042989451 8:74622301-74622323 ATGTATATGAAAAAAAATGTTGG + Intronic
1043587612 8:81787382-81787404 ATGCTTGTTAATCAAAATAAAGG - Intergenic
1043662763 8:82765942-82765964 TAGCATAGTAATACAAATGATGG + Intergenic
1043691769 8:83162846-83162868 ATGGATTTTCATAAAAATCAAGG + Intergenic
1043964571 8:86459355-86459377 ATGCAAATTAACAAAAATGTTGG + Intronic
1044054530 8:87552185-87552207 ACAAATATTAAAAAAAATGATGG + Intronic
1044206118 8:89493844-89493866 TTGGATAGTAATAAAAGTGAAGG + Intergenic
1044676327 8:94732298-94732320 AAGCATAATAAAAAAAATAAGGG - Intronic
1044690656 8:94874245-94874267 ATGCATATCAAAAAAAAAAACGG - Intronic
1045044194 8:98258935-98258957 CTGCGTATTAAAAAAAATGGTGG + Intronic
1046298930 8:112259923-112259945 ATGCATATTCAAATAAAGGAGGG + Intronic
1046369832 8:113288204-113288226 CTCTATATAAATAAAAATGATGG + Intronic
1046381699 8:113459491-113459513 GTGCTTATTTTTAAAAATGATGG + Intergenic
1046613316 8:116448908-116448930 AGGAATATAGATAAAAATGAGGG - Intergenic
1047068032 8:121309067-121309089 ATGTATATTAATTCAAATAATGG + Intergenic
1047491533 8:125378742-125378764 ATGCATTTTATAAGAAATGACGG - Intergenic
1047598559 8:126403712-126403734 AAGGATATTAGTAAAAGTGATGG + Intergenic
1047711039 8:127552799-127552821 ATACAAATAAATAAAATTGAAGG + Intergenic
1048276870 8:133072875-133072897 ATACATATTCAGAAAAATGGAGG + Intronic
1048497922 8:134950545-134950567 TTGCATATATAGAAAAATGAAGG + Intergenic
1048555987 8:135476440-135476462 ATTCTTATTAATAAAAATGGGGG - Intronic
1048818024 8:138352229-138352251 ATGCATTTTAATAATAAGTAGGG + Intronic
1049036397 8:140079628-140079650 GTGCATAATAATAAAAAGGCAGG + Intronic
1050481256 9:6089355-6089377 ATCTATATGAATAACAATGAAGG - Intergenic
1051137358 9:13937346-13937368 TTGCACATTAAAAAAAAAGAAGG + Intergenic
1051631172 9:19142185-19142207 AGGCATCTTCACAAAAATGAAGG - Intronic
1051817856 9:21130893-21130915 ATGCATATTAATTTGAATGCAGG - Intergenic
1052488596 9:29133586-29133608 TTGCATTTTAAAAAAAATGATGG - Intergenic
1052638044 9:31128009-31128031 ATGAATATAAATAAAATTAATGG - Intergenic
1052655746 9:31357903-31357925 ATGAATAATGATAAAAATAATGG + Intergenic
1053676990 9:40442090-40442112 AAGTTTATTAATAAAATTGAAGG - Intergenic
1053926754 9:43068190-43068212 AAGTTTATTAATAAAATTGAAGG - Intergenic
1054286728 9:63182815-63182837 AAGTTTATTAATAAAATTGAAGG + Intergenic
1054290060 9:63277619-63277641 AAGTTTATTAATAAAATTGAAGG - Intergenic
1054388089 9:64582159-64582181 AAGTTTATTAATAAAATTGAAGG - Intergenic
1054507633 9:65934209-65934231 AAGTTTATTAATAAAATTGAAGG + Intergenic
1054863178 9:69973954-69973976 ATGGATTTTGATATAAATGAGGG + Intergenic
1055077496 9:72231038-72231060 ATGAACACTAATAACAATGACGG - Intronic
1055489114 9:76786690-76786712 TTGGAAATTAATAAAAATAAGGG - Intronic
1055794599 9:79961903-79961925 TTTCATATTATTAAAAATGAAGG + Intergenic
1055851253 9:80632953-80632975 ATGTGTATTTATAAAAATTAAGG + Intergenic
1055870894 9:80878439-80878461 ATGGATGTAAATAAATATGATGG + Intergenic
1055994885 9:82146594-82146616 ATGAATATAAACAAAAAGGAAGG + Intergenic
1056129796 9:83573017-83573039 TTGCAGAAAAATAAAAATGACGG + Intergenic
1056269011 9:84928164-84928186 TTGTATCTTAATAAAAATGTAGG + Intronic
1056484266 9:87039082-87039104 AGGCATATTAAATAAAATGAAGG - Intergenic
1057070846 9:92098566-92098588 GTGCATATTGAAAAAAAAGAAGG + Intronic
1058202105 9:102056599-102056621 ATGCATATTGATTAAAATCAGGG + Intergenic
1058306313 9:103445516-103445538 TTACATATCAATAAAAATGGGGG - Intergenic
1059549022 9:115208856-115208878 CTTCATATTAATAAAAATTATGG + Intronic
1059979999 9:119761190-119761212 ATGCATATTACAAAAAATACAGG - Intergenic
1060278025 9:122197027-122197049 ATGTACATTTCTAAAAATGAGGG - Intronic
1186129069 X:6446778-6446800 CTGCATAGAAATAAAGATGAAGG - Intergenic
1186542709 X:10417279-10417301 AAGCATTTTAAGAAAAAAGAGGG + Intergenic
1186733545 X:12436308-12436330 ATAAATAATACTAAAAATGAAGG - Intronic
1186951152 X:14626780-14626802 ATAGATGTAAATAAAAATGAAGG + Intronic
1187657254 X:21490754-21490776 ATGAAGATAAATGAAAATGAAGG + Intronic
1187724595 X:22189411-22189433 ATGCCTATTAATGAGAATAACGG - Intronic
1188455873 X:30365036-30365058 ATTCATGTTGCTAAAAATGATGG + Intergenic
1188754360 X:33942866-33942888 TTGCATATTAATGAAAAGAAAGG + Intergenic
1189017990 X:37304120-37304142 ATGCAAAATTATAAAAATCATGG - Intergenic
1189240581 X:39521609-39521631 ATGCCTATTATTCAAGATGATGG + Intergenic
1189828263 X:44942674-44942696 ATATATATAAATAAAAATTAGGG + Intronic
1189875126 X:45428583-45428605 AAGCATATTTTTAAAGATGAGGG + Intergenic
1192284485 X:69720430-69720452 ATGAATATTCAAAAAAATAATGG - Intronic
1192633884 X:72800358-72800380 AAGCATATTTAGAAAAATAACGG - Intronic
1192647826 X:72920443-72920465 AAGCATATTTAGAAAAATAACGG + Intronic
1193232482 X:79064754-79064776 ATTCATATTCAGAAGAATGAAGG - Intergenic
1193289854 X:79759982-79760004 ATAAAAATTAATAAAACTGAAGG - Intergenic
1194122101 X:89974536-89974558 ATTCATTTTAAGCAAAATGAGGG - Intergenic
1194692218 X:97001051-97001073 ATGCATATTAAGAAAATGAAAGG - Intronic
1195272020 X:103241699-103241721 AGGCATGTCAATAACAATGAAGG - Intergenic
1195751754 X:108166565-108166587 ATGAAAATTTATAAAAGTGATGG + Intronic
1196045666 X:111253883-111253905 ATACATATTAATAACAAAAAAGG - Intronic
1196293749 X:113976299-113976321 AGGCATATTAATAGGAAGGAAGG - Intergenic
1196382899 X:115111831-115111853 ATGCAACTTATTAAAAATGTTGG - Exonic
1196406498 X:115367919-115367941 CTGTATATTAAAAAAAATAATGG - Intergenic
1197110613 X:122769845-122769867 AAAAATATTATTAAAAATGAGGG - Intergenic
1197264311 X:124349814-124349836 ATACTTATTACTTAAAATGAAGG - Intronic
1197371005 X:125626684-125626706 CTTCATATTAAAAAAAATTATGG - Intergenic
1197548039 X:127851631-127851653 ATCCATATTACTAAAAGAGATGG - Intergenic
1197607721 X:128604914-128604936 ATGCATTTTTAAAATAATGAAGG + Intergenic
1197817767 X:130515929-130515951 ATTCATTTTAATAAAAATTTGGG + Intergenic
1198165711 X:134053879-134053901 ATCCATATGCAGAAAAATGAAGG - Intergenic
1198229544 X:134676152-134676174 ATGCTTTTTAATTAAAATAAAGG - Intronic
1198443701 X:136690011-136690033 AGGCTTATAAATAAAAATGTGGG + Intronic
1198671856 X:139089839-139089861 ATCAATAATAATAATAATGATGG - Intronic
1198817082 X:140603157-140603179 ATGCATATTTATTAAGATGGCGG - Intergenic
1199161095 X:144612934-144612956 ATGGATATTAAAATAAATAATGG + Intergenic
1199195895 X:145030255-145030277 ATGCATCTAATAAAAAATGAGGG + Intergenic
1199202652 X:145110923-145110945 ATGTTTATAATTAAAAATGAAGG - Intergenic
1199322261 X:146454748-146454770 ACTCATAATATTAAAAATGATGG - Intergenic
1200474956 Y:3631969-3631991 ATTCATTTTAAGCAAAATGAGGG - Intergenic
1200915859 Y:8570658-8570680 ATGAAAATAAATAAAAATCAAGG - Intergenic
1200927272 Y:8665823-8665845 ATGCAAAAAAAAAAAAATGAAGG + Intergenic
1201577195 Y:15473664-15473686 AAGCATAATAATAATAATAATGG - Intergenic
1202018669 Y:20440361-20440383 GTGGATATTAATAAAAAGTAAGG + Intergenic
1202131762 Y:21618620-21618642 TGGCATATTAATAAGAAAGAGGG + Intergenic