ID: 1041700969

View in Genome Browser
Species Human (GRCh38)
Location 8:60788582-60788604
Sequence TAGGGTAAAGAATTTGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041700960_1041700969 29 Left 1041700960 8:60788530-60788552 CCCTCTTCCTTTCCTGCTAACAG 0: 1
1: 0
2: 2
3: 31
4: 467
Right 1041700969 8:60788582-60788604 TAGGGTAAAGAATTTGTGGCTGG No data
1041700961_1041700969 28 Left 1041700961 8:60788531-60788553 CCTCTTCCTTTCCTGCTAACAGG 0: 1
1: 0
2: 3
3: 28
4: 274
Right 1041700969 8:60788582-60788604 TAGGGTAAAGAATTTGTGGCTGG No data
1041700963_1041700969 22 Left 1041700963 8:60788537-60788559 CCTTTCCTGCTAACAGGTCTCCT 0: 1
1: 0
2: 5
3: 17
4: 163
Right 1041700969 8:60788582-60788604 TAGGGTAAAGAATTTGTGGCTGG No data
1041700965_1041700969 2 Left 1041700965 8:60788557-60788579 CCTCTTTCTTTTTCAACTAGAAG 0: 1
1: 0
2: 1
3: 37
4: 444
Right 1041700969 8:60788582-60788604 TAGGGTAAAGAATTTGTGGCTGG No data
1041700964_1041700969 17 Left 1041700964 8:60788542-60788564 CCTGCTAACAGGTCTCCTCTTTC 0: 1
1: 0
2: 2
3: 22
4: 205
Right 1041700969 8:60788582-60788604 TAGGGTAAAGAATTTGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041700969 Original CRISPR TAGGGTAAAGAATTTGTGGC TGG Intronic
No off target data available for this crispr