ID: 1041704890

View in Genome Browser
Species Human (GRCh38)
Location 8:60836141-60836163
Sequence CAGGCAATGATCCAGGCTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041704887_1041704890 -8 Left 1041704887 8:60836126-60836148 CCAGATTTTCAGCTCCAGGCAAT 0: 1
1: 0
2: 4
3: 20
4: 309
Right 1041704890 8:60836141-60836163 CAGGCAATGATCCAGGCTGCTGG 0: 1
1: 0
2: 2
3: 18
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041704890 Original CRISPR CAGGCAATGATCCAGGCTGC TGG Exonic
901142943 1:7047122-7047144 CACTCAGGGATCCAGGCTGCTGG - Intronic
901613124 1:10515083-10515105 CTGGCACAGATCCATGCTGCTGG - Intronic
901852023 1:12021888-12021910 CAGGCCAGCATCCAGGCTTCTGG + Intronic
902330605 1:15729448-15729470 CAGGCAGAGAGCCATGCTGCTGG + Intronic
904020361 1:27459429-27459451 CAGGCATTGAGCCATCCTGCTGG + Intronic
904339897 1:29827978-29828000 CAGGCAATGCACCAGGCATCAGG + Intergenic
904413640 1:30341603-30341625 CTGGCTGGGATCCAGGCTGCAGG - Intergenic
906375935 1:45296664-45296686 CAGTCAATGAACCAGGAAGCAGG + Intronic
907638930 1:56166130-56166152 TAGGAAATGATCCAGGTGGCAGG + Intergenic
908411628 1:63871623-63871645 CAGGCAACCATACAGGCTCCAGG + Intronic
912964185 1:114223022-114223044 CAGGCACTGATCCAGGTTTTAGG - Intergenic
913287046 1:117236180-117236202 CAGGCACTCTTCCAGGCAGCTGG + Intergenic
915835750 1:159173294-159173316 CAGGCGAAGAGCCAGGGTGCTGG + Intronic
918096124 1:181335597-181335619 CAGGGCATGCTCCAGGATGCAGG - Intergenic
920720410 1:208381628-208381650 CTGGCTAAGACCCAGGCTGCTGG + Intergenic
921974219 1:221183346-221183368 CAGGCAATACTCCCAGCTGCAGG + Intergenic
922210597 1:223483651-223483673 CAGGCACTGACCCAGGCCCCAGG + Intergenic
924379910 1:243453001-243453023 CAGGCACTGTTCTAGGCAGCAGG - Intronic
1064301175 10:14124282-14124304 CAGGCAATGATCATGGCACCTGG - Intronic
1065145619 10:22764773-22764795 CAGTCAATGATCCAGGAGGGAGG + Intergenic
1065636670 10:27742239-27742261 CAGGCCACGCTCCAGGCTCCTGG - Intronic
1067574750 10:47402129-47402151 AAGGCAGGAATCCAGGCTGCTGG - Intergenic
1067740095 10:48888993-48889015 CAGGCACTGAGCCAGGCTTTGGG - Intronic
1068548674 10:58382174-58382196 CAGGGAATTATCCAGGTTTCTGG + Intergenic
1069801253 10:71083136-71083158 CAGGCACTTGTGCAGGCTGCAGG - Intergenic
1069824002 10:71244277-71244299 CAGGCATTGGCCCAGGCTGTAGG - Intronic
1069832779 10:71291277-71291299 AAGGGAGTGACCCAGGCTGCGGG + Intronic
1073985901 10:109208601-109208623 CTGGCAATGTTCCAGGGAGCTGG - Intergenic
1074116314 10:110459799-110459821 CAGGCCATGCTCCTGGCTTCCGG - Intergenic
1074831851 10:117254932-117254954 CAGGCAAGGCTGCAGGCTCCTGG - Intronic
1075444476 10:122504155-122504177 CAGGCAGGGATGGAGGCTGCAGG - Intronic
1075672811 10:124275092-124275114 CAGGCCATGAGCCAGGATGTAGG - Intergenic
1076163503 10:128263941-128263963 CAGAGAATGATCCCGGCTGTGGG + Intergenic
1077089071 11:770147-770169 CAGACAGTGGTCCAGCCTGCTGG - Exonic
1077133129 11:984609-984631 CAGGCAATGAGACACGCTGCCGG - Intronic
1077201750 11:1311007-1311029 CAGGCAAGCGGCCAGGCTGCCGG - Intergenic
1077556476 11:3228431-3228453 CAGGCACTGCTCCACGCTGACGG + Exonic
1077644780 11:3913586-3913608 CAGGGAATCATCCAGGCATCAGG - Intronic
1078149558 11:8747161-8747183 CAGGCATTGTTCCAGGCTCTAGG + Intronic
1078428397 11:11269231-11269253 CAGGCAGTGATGCAGGCTGCTGG + Intergenic
1078959172 11:16243664-16243686 CAGGCAATCATCCATGCTCCTGG + Intronic
1079426841 11:20351691-20351713 CAGGCACTAATCCAGGTGGCAGG + Intergenic
1080730250 11:34943759-34943781 CAGGCAGTGATCCAGGTAGAAGG - Intronic
1080796201 11:35565898-35565920 CAGGCTGTGATCCAGGCAGGTGG - Intergenic
1081278070 11:41175456-41175478 CATTCAAGGATCCAGGCTGTTGG + Intronic
1081707088 11:45188791-45188813 CAGGCCAGGAACCATGCTGCTGG + Intronic
1082809658 11:57471749-57471771 CAGGCAATGTTCCAGGTGCCAGG + Intronic
1083160869 11:60853330-60853352 CAGGCAGCGGTCCAGGCTGATGG + Exonic
1084285374 11:68127858-68127880 CAGGCAAAAGTCCAGCCTGCAGG - Intergenic
1085157561 11:74310635-74310657 CAGGCAGTGTTCCAGGCAGTGGG - Intronic
1086941641 11:92804199-92804221 CAGGCATTGTTCTAGGCAGCAGG - Intronic
1089432544 11:118436223-118436245 CATGCAGTTATCCAGGTTGCGGG + Intergenic
1090728629 11:129550778-129550800 CAGGCAATGATAGAGGCAGGAGG + Intergenic
1090828318 11:130403471-130403493 CTGGTAATGATGCAGGCAGCAGG + Intergenic
1090832892 11:130431323-130431345 CAGTCAATGAACCAGTCAGCAGG - Intergenic
1091194533 11:133719971-133719993 CAGGGGATGCTCCTGGCTGCAGG - Intergenic
1091479374 12:810886-810908 CATGCACAGTTCCAGGCTGCTGG - Intronic
1091634222 12:2185276-2185298 CAGGAAGTGCTCCAGGCTGGAGG - Intronic
1093351259 12:18105544-18105566 CAGGAGCTGAACCAGGCTGCGGG - Intronic
1103779112 12:123387934-123387956 CAGGCCATGGGCCAGGCTGCAGG + Intronic
1103956422 12:124579496-124579518 CAGGTAATGTTCCAGGCACCAGG + Intergenic
1104529733 12:129558141-129558163 CAGGCAAGAATCCAGGCTGATGG + Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1105069481 12:133226089-133226111 CAGGTGATGAGTCAGGCTGCAGG + Intronic
1106208933 13:27622927-27622949 CTGGAAATGGTCCAGGCAGCTGG + Exonic
1107134091 13:36925215-36925237 CAGGCATTGTTCCAGGCTGTGGG - Intergenic
1111744185 13:92245086-92245108 CAGGCACTCTCCCAGGCTGCTGG + Intronic
1111908489 13:94283502-94283524 AAGGCAAGGAGCCAGGATGCAGG - Intronic
1112694064 13:101927822-101927844 CAGGCACTGCTCCAGGCTCTGGG - Intronic
1113024840 13:105929141-105929163 CAGGCAATGTGCCAGGCTTGGGG - Intergenic
1114349084 14:21830090-21830112 CAGGTTATGGTACAGGCTGCAGG - Intergenic
1116628365 14:47296916-47296938 AAGACAATGATCCAGGCCACTGG + Intronic
1117046977 14:51822977-51822999 AAGGCAATGAGCCAGGCTTGTGG - Intergenic
1117769521 14:59118947-59118969 CAGCCAATGACCTAGGCTTCAGG - Intergenic
1120512358 14:85430769-85430791 CAGGCACTGTTCTAGGCTGTTGG + Intergenic
1121793131 14:96713741-96713763 CCTGCAAGGATCCAGGCTGATGG - Intergenic
1122632421 14:103113045-103113067 CAGGCACTGGCCAAGGCTGCGGG - Intergenic
1122777995 14:104131287-104131309 CGGGAAAAGATCCAGGCTGCGGG + Intergenic
1123930866 15:25171116-25171138 TGGGCCATGAGCCAGGCTGCTGG + Intergenic
1126303571 15:47228230-47228252 CAGGCATGGTTCCAGGCTGCTGG - Intronic
1128933800 15:71728405-71728427 CAGGCAATGATCCAGGCCCTGGG - Intronic
1129064348 15:72888733-72888755 CAGGTAATGATGGAGACTGCAGG + Intergenic
1129476722 15:75790836-75790858 CAGGCAAGGGCTCAGGCTGCTGG + Intergenic
1131680582 15:94718176-94718198 AAGGCAATGATCTATCCTGCTGG - Intergenic
1132143683 15:99414480-99414502 CGGGCCATGGTCCTGGCTGCTGG - Intergenic
1132589348 16:719907-719929 CAGGGAATAATGCAGGCAGCAGG + Intronic
1134514034 16:14872490-14872512 AAGGAAAGGATCAAGGCTGCTGG - Intronic
1134970154 16:18523661-18523683 AAGGAAAGGATCAAGGCTGCTGG + Intronic
1136188398 16:28601227-28601249 GAGGTGATGATCCAGGATGCGGG - Intergenic
1136190867 16:28614221-28614243 GAGGTGATGATCCAGGATGCGGG - Intronic
1136281201 16:29212422-29212444 CAGGCTATGAACGGGGCTGCAGG + Intergenic
1137998494 16:53247361-53247383 CAAGCAATGATCCAGTCTGCTGG + Exonic
1138190383 16:55009430-55009452 CAGGCACTGAGCCGGGCTGGGGG + Intergenic
1141021815 16:80504021-80504043 CAAGCATTGAACCAGGGTGCTGG + Intergenic
1141785625 16:86198686-86198708 CAGGCCAGGACGCAGGCTGCAGG + Intergenic
1142004327 16:87682142-87682164 CAGGAAATGAAGCAAGCTGCTGG - Intronic
1142085565 16:88178345-88178367 CAGGCTATGAACGGGGCTGCAGG + Intergenic
1144790341 17:17854861-17854883 TGGGCAATGATCCAAGCTGAAGG + Intronic
1144851917 17:18248120-18248142 CAGTCAGTGAGCCACGCTGCAGG - Intronic
1145293991 17:21574112-21574134 CAGGCAATCCTTGAGGCTGCAGG + Intronic
1146521962 17:33532270-33532292 CAGGCACTGTGCCAGGCTGTGGG + Intronic
1146924266 17:36733239-36733261 AAGAGCATGATCCAGGCTGCTGG - Intergenic
1148455737 17:47810534-47810556 CAGGCAATCCTTCAGGCTGGAGG - Intronic
1148843632 17:50515500-50515522 CTGGCACTGATCCATGCTTCTGG - Intronic
1150249772 17:63699282-63699304 CGAGCCATGTTCCAGGCTGCAGG - Exonic
1152651087 17:81493296-81493318 CAGGCAGTACTCCAGGCTTCAGG + Intergenic
1153481750 18:5554271-5554293 CAGGCACTGTTCCAGGTGGCTGG - Intronic
1153799579 18:8657639-8657661 CACGCACTGCCCCAGGCTGCAGG + Intergenic
1154354135 18:13611931-13611953 CAGGCTGCGAGCCAGGCTGCGGG - Intronic
1155184164 18:23372842-23372864 CAGGCACTGAGCCAGGCTCTGGG - Intronic
1156685571 18:39641500-39641522 CAGGCACTGAGCCAGACTCCAGG + Intergenic
1157276598 18:46315117-46315139 CAGGCTGGGAGCCAGGCTGCAGG + Intergenic
1158266720 18:55667045-55667067 CAGGGCATGCTGCAGGCTGCAGG + Intergenic
1158564309 18:58541626-58541648 CAGGCACTGTTCTAGGCAGCTGG + Intronic
1160770153 19:827544-827566 CTGGCAATGTTCCTGGGTGCTGG + Intronic
1160944419 19:1634589-1634611 CAAGGAATGCTCCAGGCTGGTGG + Intronic
1161166814 19:2792071-2792093 CAGGGACTAATCCAGGCAGCTGG - Intronic
1162084528 19:8240536-8240558 CAGGCAGCGGGCCAGGCTGCAGG + Intronic
1162305451 19:9870519-9870541 CAGGCACTGAACCAGGATGTAGG + Intronic
1163368683 19:16889969-16889991 CAGGTAGCGATCCAGGCTGACGG - Exonic
1163726989 19:18928504-18928526 CTGGCCAAGATTCAGGCTGCAGG + Exonic
1164783309 19:30910629-30910651 CAGGCCCTGCTCCAGGCTGCTGG - Intergenic
1165332648 19:35149648-35149670 CTGGCAATGTTCCAAGCAGCTGG + Intronic
1166518773 19:43465522-43465544 CAGGCCATGATCTGGACTGCAGG - Exonic
1166676122 19:44742123-44742145 CAGGCCATGCTCCAGGAAGCTGG + Intergenic
925067475 2:939571-939593 CTTGGAATGAGCCAGGCTGCCGG + Intergenic
927818805 2:26244678-26244700 CAGGCAGTGCTCCAGGCGCCTGG - Exonic
930724216 2:54666937-54666959 CAGCCAAGGAGCCAGGCTGCCGG - Intronic
931470199 2:62531865-62531887 CAGGCAGACATCCAGGCAGCTGG - Intergenic
932118635 2:69077719-69077741 CTGGCAGTGAGCCAGGCTTCAGG + Intronic
933240246 2:79913010-79913032 CAGGCATTGCTCTAGGCTTCTGG + Intronic
933547135 2:83729094-83729116 CAGGCAATGCTTCAGGCAACTGG - Intergenic
934564503 2:95330805-95330827 CAGGCAATGTCCCAGGCTCTGGG + Intronic
938050110 2:128161969-128161991 CTGGCAATGCTCAAGGGTGCCGG + Intronic
939569956 2:143829360-143829382 CAGGCAATTTTCCAGGCAGATGG + Intergenic
939738309 2:145877285-145877307 CATGGAATGATACAGCCTGCAGG + Intergenic
942229922 2:173851280-173851302 TAGGCACTGTTTCAGGCTGCTGG + Intergenic
944429520 2:199617885-199617907 CAGGCAAGAATCCTGGCAGCTGG + Intergenic
946138170 2:217665252-217665274 CAGGCAAAGATAAAGGCTGCTGG - Intronic
947082872 2:226418721-226418743 GAGGCAATGACTCAGGCTGGTGG - Intergenic
948869007 2:240789055-240789077 AAGGCAGTGATGGAGGCTGCAGG - Intronic
1170240919 20:14165092-14165114 CAGGGAATGATGCAGTCTGATGG + Intronic
1170359187 20:15525824-15525846 CACACAATGATCCAGACAGCTGG + Intronic
1171570909 20:26251135-26251157 CAGGCAATCACTGAGGCTGCGGG + Intergenic
1172114165 20:32563807-32563829 CAGGCAATGTCCCAGGCTCTAGG - Intronic
1172512664 20:35511529-35511551 CAGGGACTCATCCAGCCTGCGGG - Exonic
1172971331 20:38875121-38875143 CAGCAAATGATCCATCCTGCAGG + Intronic
1173250447 20:41361633-41361655 CAGCCAAGGCTCCAGGCTTCAGG - Exonic
1173266074 20:41483429-41483451 CAGGCCATGATTCAGGCAGCAGG - Exonic
1173457261 20:43213457-43213479 CACTCAAGGATCCAGGCTGAGGG + Intergenic
1174513471 20:51073564-51073586 CAGGCACTGTTCCAGGCTCTAGG + Intergenic
1178374504 21:32055821-32055843 CATGCAAAGATCTAGGTTGCTGG + Intergenic
1180051576 21:45333905-45333927 GAGACAATGAGACAGGCTGCTGG - Intergenic
1180573075 22:16748148-16748170 CAGGCAATCACTGAGGCTGCGGG + Intergenic
949857565 3:8475823-8475845 CAGGCACTGGACCTGGCTGCAGG + Intergenic
950156751 3:10726775-10726797 CAGTCAAAGATCCAGGTTCCAGG - Intergenic
950637235 3:14323753-14323775 AAGGCAGTGATACATGCTGCTGG - Intergenic
960327286 3:116313311-116313333 CATGTAATTATCCAGGCAGCAGG - Intronic
961520845 3:127466637-127466659 CAGCCAGGGGTCCAGGCTGCAGG + Intergenic
961931299 3:130536362-130536384 CAGGCACTGTTCCAGACTCCAGG + Intergenic
962671855 3:137716221-137716243 CAGGCACTGATCCAGGCATTTGG - Intergenic
962958958 3:140292219-140292241 CATGCAAGGATCCAGCCTGTTGG - Intronic
963273400 3:143307539-143307561 GAGGCAAAGACCCAGCCTGCAGG - Intronic
964164894 3:153691328-153691350 CAGACAAGGACCCAGGCTGATGG + Intergenic
964326673 3:155554019-155554041 CAGGCAATGCTCCATGCGGGAGG + Intronic
968131037 3:196192957-196192979 CAGGCAGTGTTTCAGGCTGAAGG - Intergenic
968856731 4:3130592-3130614 CAGGCAATTCTCAAGGCTGTGGG - Intronic
968862736 4:3185366-3185388 CAGGCGAGGGTCCAGGATGCAGG + Intronic
969949131 4:10816064-10816086 CAGGCAATGATACAGGTACCGGG + Intergenic
974363417 4:60913844-60913866 CTGACAATGATGCAGGCTGTGGG - Intergenic
976000425 4:80367973-80367995 CAGGCAAGTATCCAGCCTGAGGG - Intronic
976105493 4:81612801-81612823 CAGGCAACTATTTAGGCTGCTGG + Intronic
976288178 4:83390239-83390261 CTGGGAATGCTCAAGGCTGCTGG + Intergenic
980027358 4:127782324-127782346 TAGGGAAAGACCCAGGCTGCGGG + Exonic
983411260 4:167401462-167401484 CATGCACTGTTCCAGGCTGTGGG - Intergenic
984164308 4:176288960-176288982 GAGGGAATGAACCAAGCTGCTGG - Intergenic
984376506 4:178937679-178937701 CAGGCAATAATCCTGGAAGCAGG - Intergenic
984445194 4:179828145-179828167 GAGGGAATGATACAGGCTGAAGG + Intergenic
987110499 5:14681548-14681570 CAGGCCATGAGCCAGGCTGTGGG + Exonic
987962166 5:24824296-24824318 CAGGCAGTAATCCAGGCAGCTGG - Intergenic
988260539 5:28881868-28881890 CAGGCTGTGATGTAGGCTGCAGG - Intergenic
990400141 5:55429656-55429678 CAGGGAATGATGCAGTCTGCTGG - Intronic
990653872 5:57933259-57933281 AAGGCAAAAATCCAGGCTGGAGG + Intergenic
990928137 5:61053156-61053178 CATTCAAAGATCCAGGCTGATGG - Intronic
996916521 5:128719037-128719059 CAGGCAATGAGGCAGGCCCCAGG + Intronic
997564150 5:134874422-134874444 TGGGCAATGGTCCCGGCTGCCGG + Exonic
998888961 5:146726070-146726092 CAAGTAATGATCAAGGCTCCAGG - Intronic
998986125 5:147759452-147759474 CAGGCACTGTTCTAGGCTTCAGG + Intronic
1000120230 5:158190183-158190205 CAGTCAAATATCCAGACTGCAGG - Intergenic
1001410502 5:171508151-171508173 CAGGTAATACTCCAGGCAGCTGG + Intergenic
1002913691 6:1511093-1511115 CAGGCACTGTTCCAGGCTCTGGG - Intergenic
1003520362 6:6853475-6853497 CAGGCACTGTTCCAGGCTTTGGG + Intergenic
1003693375 6:8377092-8377114 AAGGAAATGTTCCAGGCAGCCGG - Intergenic
1006834481 6:36988964-36988986 CAGGCATTGAGCCAGGCTTGGGG - Intergenic
1007278719 6:40694558-40694580 CAAGTATTGATCCAGGCTGGTGG - Intergenic
1007704430 6:43782276-43782298 CAGGCACTGGTCCAGCCTGGCGG + Intronic
1008185706 6:48388311-48388333 CAGTCAATGATTCAGGCATCAGG + Intergenic
1013548413 6:111182941-111182963 CTGGCAGTGATCCAGGCTAGGGG - Intronic
1016874373 6:148850281-148850303 CAGACGCTGGTCCAGGCTGCTGG - Intronic
1018940266 6:168304852-168304874 GAGGCAAGGAGCCAGGGTGCCGG + Intronic
1019426296 7:978605-978627 CAGGCACTGCTCCAGGCTCTGGG - Intergenic
1019647021 7:2136388-2136410 CTGGCACTGATCCTGCCTGCTGG - Intronic
1022636871 7:32144451-32144473 CAGGCAATCATCATGGCTGGAGG + Intronic
1024095300 7:45978086-45978108 CATGCAATGATGCTGTCTGCTGG + Intergenic
1025285229 7:57655180-57655202 CAGGCAATCACTGAGGCTGCGGG + Intergenic
1026428210 7:70317698-70317720 CAGGCAATGTGCCAGCCTGAGGG - Intronic
1028829220 7:95308652-95308674 AATGCAAGTATCCAGGCTGCTGG - Intronic
1029172334 7:98639907-98639929 CAAGGAATGGTCCAGGCTCCAGG - Intergenic
1029477326 7:100792697-100792719 CAGAGAAGGAGCCAGGCTGCCGG - Intronic
1030291626 7:107878550-107878572 AAGGCATTGTTCCAGGCTCCGGG + Intergenic
1031645325 7:124219005-124219027 CAGGCAATGAAACAGGCTTGGGG + Intergenic
1032537768 7:132678682-132678704 CAGACATTGAGCCAGGCAGCAGG + Intronic
1038327036 8:26579170-26579192 CAGACAATGATCGCGGCGGCCGG + Intronic
1040491742 8:47929575-47929597 AAAGCAATGCTCAAGGCTGCCGG + Intronic
1040931271 8:52738010-52738032 CAAGCACTGGGCCAGGCTGCTGG - Intronic
1041441963 8:57906847-57906869 CAGACAATGATACATTCTGCTGG + Intergenic
1041704890 8:60836141-60836163 CAGGCAATGATCCAGGCTGCTGG + Exonic
1042474648 8:69233308-69233330 CAGGCACTGTTCCAGGTTCCTGG - Intergenic
1045392179 8:101726360-101726382 CATGCAATGATCCAGGCAAGAGG + Intronic
1045400613 8:101813047-101813069 CAGGCAATGTGCTAGGCTGGGGG + Intronic
1047514764 8:125544615-125544637 CAGTCAATGACCCACTCTGCAGG - Intergenic
1048255378 8:132901407-132901429 CAGGCTATGTCCCAGCCTGCAGG + Exonic
1048371147 8:133777299-133777321 CAGACAATGATCTAGGCCCCAGG + Intergenic
1048636374 8:136300372-136300394 TAGGCAATTATCCAGGCTGGGGG - Intergenic
1049865652 8:144933894-144933916 CAGGGAGTGATCCAGGCTGTGGG - Intronic
1052993102 9:34533620-34533642 CACTCAAGCATCCAGGCTGCTGG + Intergenic
1055719866 9:79160894-79160916 CAAACAATGATCCAGGGTGCTGG - Intergenic
1056497503 9:87173712-87173734 CAGGGAATGACCCTGGCTTCTGG + Intergenic
1056718626 9:89054589-89054611 AAGGCAGTCATCCAGCCTGCTGG + Intronic
1058638569 9:107060453-107060475 CAGGCAATGCTCCCAGCAGCTGG + Intergenic
1059544788 9:115165599-115165621 GATGCAGAGATCCAGGCTGCAGG + Intronic
1060050158 9:120372905-120372927 GAGGAACTGATCCAGGCTGAAGG + Intergenic
1060050169 9:120372984-120373006 GAGGAACTGATCCAGGCTGAAGG + Intergenic
1060408024 9:123382279-123382301 CCGGCCAAGCTCCAGGCTGCCGG - Exonic
1060556214 9:124508358-124508380 CAGGCACTGTTCCAGGCACCAGG + Intergenic
1060896147 9:127218849-127218871 CAGGCTGTGAGCCAGGGTGCTGG + Exonic
1060963043 9:127694689-127694711 GAGGCCCTGGTCCAGGCTGCGGG - Intronic
1061365037 9:130168224-130168246 CAGGGACAGGTCCAGGCTGCAGG - Intergenic
1062060947 9:134494699-134494721 CGGGCACTGATGCTGGCTGCTGG + Intergenic
1187408364 X:19024698-19024720 CAAAGAATGATCCAGCCTGCTGG + Intronic
1190429802 X:50368186-50368208 CAGGCTAGGATCAAGGCAGCAGG + Exonic
1195996406 X:110736075-110736097 CACACAAGGCTCCAGGCTGCTGG + Intronic
1196564299 X:117186983-117187005 CAGGCCCTGCTCCAGGCAGCAGG - Intergenic
1196834074 X:119798774-119798796 CAGGCACTGTTCCAGGCTCAGGG - Intergenic
1198028123 X:132728956-132728978 CAGGGAGTGATACAGGCTGAAGG - Intronic
1199782537 X:151075796-151075818 CAGGCACTGTTCCAGGCTCTGGG - Intergenic
1201783049 Y:17744309-17744331 CAGGTGATGAGTCAGGCTGCAGG + Intergenic
1201818504 Y:18161678-18161700 CAGGTGATGAGTCAGGCTGCAGG - Intergenic