ID: 1041712563

View in Genome Browser
Species Human (GRCh38)
Location 8:60907685-60907707
Sequence CTGTCTGACCAATGGGAAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041712559_1041712563 6 Left 1041712559 8:60907656-60907678 CCTCTAGGCAGTAGGACGGGATT No data
Right 1041712563 8:60907685-60907707 CTGTCTGACCAATGGGAAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041712563 Original CRISPR CTGTCTGACCAATGGGAAAT CGG Intergenic
No off target data available for this crispr