ID: 1041713233

View in Genome Browser
Species Human (GRCh38)
Location 8:60911622-60911644
Sequence ACTGTTGCAAATGCCTGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041713228_1041713233 27 Left 1041713228 8:60911572-60911594 CCTTTTCTCCTTTGGACTTGGTG No data
Right 1041713233 8:60911622-60911644 ACTGTTGCAAATGCCTGCTGCGG No data
1041713229_1041713233 19 Left 1041713229 8:60911580-60911602 CCTTTGGACTTGGTGTTGCTAAA No data
Right 1041713233 8:60911622-60911644 ACTGTTGCAAATGCCTGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041713233 Original CRISPR ACTGTTGCAAATGCCTGCTG CGG Intergenic
No off target data available for this crispr