ID: 1041713449

View in Genome Browser
Species Human (GRCh38)
Location 8:60913349-60913371
Sequence ACCCTGTTCTCACCTGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041713449_1041713459 16 Left 1041713449 8:60913349-60913371 CCAGATGCAGGTGAGAACAGGGT No data
Right 1041713459 8:60913388-60913410 CTCATGGAACTTTTATGGGGTGG No data
1041713449_1041713460 19 Left 1041713449 8:60913349-60913371 CCAGATGCAGGTGAGAACAGGGT No data
Right 1041713460 8:60913391-60913413 ATGGAACTTTTATGGGGTGGCGG No data
1041713449_1041713463 24 Left 1041713449 8:60913349-60913371 CCAGATGCAGGTGAGAACAGGGT No data
Right 1041713463 8:60913396-60913418 ACTTTTATGGGGTGGCGGTGGGG No data
1041713449_1041713456 11 Left 1041713449 8:60913349-60913371 CCAGATGCAGGTGAGAACAGGGT No data
Right 1041713456 8:60913383-60913405 ATGCTCTCATGGAACTTTTATGG No data
1041713449_1041713451 0 Left 1041713449 8:60913349-60913371 CCAGATGCAGGTGAGAACAGGGT No data
Right 1041713451 8:60913372-60913394 ACCCCAAGGCCATGCTCTCATGG No data
1041713449_1041713461 22 Left 1041713449 8:60913349-60913371 CCAGATGCAGGTGAGAACAGGGT No data
Right 1041713461 8:60913394-60913416 GAACTTTTATGGGGTGGCGGTGG No data
1041713449_1041713464 25 Left 1041713449 8:60913349-60913371 CCAGATGCAGGTGAGAACAGGGT No data
Right 1041713464 8:60913397-60913419 CTTTTATGGGGTGGCGGTGGGGG No data
1041713449_1041713462 23 Left 1041713449 8:60913349-60913371 CCAGATGCAGGTGAGAACAGGGT No data
Right 1041713462 8:60913395-60913417 AACTTTTATGGGGTGGCGGTGGG No data
1041713449_1041713465 30 Left 1041713449 8:60913349-60913371 CCAGATGCAGGTGAGAACAGGGT No data
Right 1041713465 8:60913402-60913424 ATGGGGTGGCGGTGGGGGCTAGG No data
1041713449_1041713458 13 Left 1041713449 8:60913349-60913371 CCAGATGCAGGTGAGAACAGGGT No data
Right 1041713458 8:60913385-60913407 GCTCTCATGGAACTTTTATGGGG No data
1041713449_1041713457 12 Left 1041713449 8:60913349-60913371 CCAGATGCAGGTGAGAACAGGGT No data
Right 1041713457 8:60913384-60913406 TGCTCTCATGGAACTTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041713449 Original CRISPR ACCCTGTTCTCACCTGCATC TGG (reversed) Intergenic