ID: 1041716935

View in Genome Browser
Species Human (GRCh38)
Location 8:60941022-60941044
Sequence CTCACATGGAAGAAGGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041716930_1041716935 15 Left 1041716930 8:60940984-60941006 CCACTTCCTGGTTTATAAACAGT No data
Right 1041716935 8:60941022-60941044 CTCACATGGAAGAAGGGCCATGG No data
1041716931_1041716935 9 Left 1041716931 8:60940990-60941012 CCTGGTTTATAAACAGTATTTCA No data
Right 1041716935 8:60941022-60941044 CTCACATGGAAGAAGGGCCATGG No data
1041716929_1041716935 16 Left 1041716929 8:60940983-60941005 CCCACTTCCTGGTTTATAAACAG No data
Right 1041716935 8:60941022-60941044 CTCACATGGAAGAAGGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041716935 Original CRISPR CTCACATGGAAGAAGGGCCA TGG Intergenic
No off target data available for this crispr