ID: 1041719283

View in Genome Browser
Species Human (GRCh38)
Location 8:60961689-60961711
Sequence CCCTGGAAAACACATCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041719283_1041719295 25 Left 1041719283 8:60961689-60961711 CCAAGAAGATGTGTTTTCCAGGG No data
Right 1041719295 8:60961737-60961759 GACATGTGTGTGCCCACACCTGG No data
1041719283_1041719291 -8 Left 1041719283 8:60961689-60961711 CCAAGAAGATGTGTTTTCCAGGG No data
Right 1041719291 8:60961704-60961726 TTCCAGGGGCTGGGGCTGGGAGG No data
1041719283_1041719293 -2 Left 1041719283 8:60961689-60961711 CCAAGAAGATGTGTTTTCCAGGG No data
Right 1041719293 8:60961710-60961732 GGGCTGGGGCTGGGAGGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041719283 Original CRISPR CCCTGGAAAACACATCTTCT TGG (reversed) Intergenic
No off target data available for this crispr