ID: 1041719292

View in Genome Browser
Species Human (GRCh38)
Location 8:60961706-60961728
Sequence CACCTCCCAGCCCCAGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041719292_1041719295 8 Left 1041719292 8:60961706-60961728 CCAGGGGCTGGGGCTGGGAGGTG No data
Right 1041719295 8:60961737-60961759 GACATGTGTGTGCCCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041719292 Original CRISPR CACCTCCCAGCCCCAGCCCC TGG (reversed) Intergenic
No off target data available for this crispr