ID: 1041719295

View in Genome Browser
Species Human (GRCh38)
Location 8:60961737-60961759
Sequence GACATGTGTGTGCCCACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041719283_1041719295 25 Left 1041719283 8:60961689-60961711 CCAAGAAGATGTGTTTTCCAGGG No data
Right 1041719295 8:60961737-60961759 GACATGTGTGTGCCCACACCTGG No data
1041719292_1041719295 8 Left 1041719292 8:60961706-60961728 CCAGGGGCTGGGGCTGGGAGGTG No data
Right 1041719295 8:60961737-60961759 GACATGTGTGTGCCCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041719295 Original CRISPR GACATGTGTGTGCCCACACC TGG Intergenic
No off target data available for this crispr