ID: 1041720058

View in Genome Browser
Species Human (GRCh38)
Location 8:60967603-60967625
Sequence GAACCATGTGTGGCTGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041720054_1041720058 7 Left 1041720054 8:60967573-60967595 CCTGTCGTCTGCGCAGCATTCAG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1041720058 8:60967603-60967625 GAACCATGTGTGGCTGCCTCTGG 0: 1
1: 0
2: 1
3: 20
4: 166
1041720053_1041720058 8 Left 1041720053 8:60967572-60967594 CCCTGTCGTCTGCGCAGCATTCA 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1041720058 8:60967603-60967625 GAACCATGTGTGGCTGCCTCTGG 0: 1
1: 0
2: 1
3: 20
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041720058 Original CRISPR GAACCATGTGTGGCTGCCTC TGG Intergenic
900602084 1:3507089-3507111 AAGCCCTGTGTGGCTGCCTGGGG + Intronic
900725640 1:4214675-4214697 GAACTATCTGTGGTTGCCTCGGG - Intergenic
900897086 1:5490890-5490912 GAAGCATGCTTGTCTGCCTCCGG - Intergenic
901170481 1:7253392-7253414 GAAGCTTGTGGGGCTGCCTTAGG + Intronic
901439629 1:9269846-9269868 GAACCGTGTGTGGCTGTTCCTGG - Exonic
901800541 1:11705567-11705589 GAACCCCGTGTGGCTGTCCCAGG - Intronic
902112991 1:14098755-14098777 CAACCCTGTGTGGCTGCCCTGGG + Intergenic
902503963 1:16927703-16927725 ACAGCCTGTGTGGCTGCCTCAGG + Intronic
902626188 1:17677794-17677816 GAACCCTGTAGGTCTGCCTCCGG + Intronic
912655800 1:111485472-111485494 GAACCTGGTGTGGTTGTCTCAGG + Intronic
912718945 1:112003592-112003614 GAATCATCTCTGCCTGCCTCGGG + Intergenic
914826363 1:151140402-151140424 GATCCAGGTCTGTCTGCCTCTGG + Intronic
916025372 1:160828996-160829018 AAAACATTAGTGGCTGCCTCTGG + Intergenic
918238082 1:182599412-182599434 GAACAAAGTGTGGAGGCCTCGGG - Exonic
923247442 1:232146131-232146153 GAACCTTGGGTGACTGCATCAGG + Intergenic
1063317849 10:5023558-5023580 GAAACACGTGTGGCTGGATCGGG + Intronic
1064239047 10:13608269-13608291 AAATCATGTGAGGCTGCCTCTGG + Intronic
1064352425 10:14588550-14588572 GAGCCAGATGTGGGTGCCTCCGG - Intronic
1067030569 10:42876781-42876803 GAAACATGTGGTGCTGCATCTGG + Intergenic
1067769702 10:49114743-49114765 GAACTCTGTCTGGCTGCCTCAGG - Intronic
1068044011 10:51862534-51862556 GCCCCATGTGTGGCTGAGTCTGG + Intronic
1069643221 10:69970087-69970109 GAACCCTATGTGAGTGCCTCAGG - Intergenic
1070156894 10:73840917-73840939 GAAGCGTGGCTGGCTGCCTCCGG - Intronic
1070261935 10:74864834-74864856 CCACCAAGTGTGGCTGCCTTTGG - Intronic
1076375209 10:129979118-129979140 GAACTAAGTGTGGCGGCCTCAGG + Intergenic
1077021199 11:417824-417846 GAACCAGGTGAGGCCGCCTCAGG - Intergenic
1077298176 11:1835655-1835677 GAACCCGCTGTGGCTCCCTCGGG - Intronic
1083227057 11:61291876-61291898 GCCCCAGGGGTGGCTGCCTCAGG + Intronic
1088711746 11:112514481-112514503 GAACCATGTGAGACAGCCACGGG - Intergenic
1094419535 12:30256054-30256076 GAAGCACGTGTGGCTGGCTGAGG + Intergenic
1094428574 12:30341589-30341611 GAAGCACGTGTGGCTGGCTGAGG - Intergenic
1095417864 12:41995466-41995488 GAAGAATGTGTGGCTGCTTTTGG - Intergenic
1097191914 12:57223559-57223581 GTACCATGTGTGTCAGCCTGGGG - Intronic
1101267524 12:103104807-103104829 GAACCTTATGTGGATGCCTCAGG - Intergenic
1102779849 12:115554681-115554703 AAACCTTGTGTGTCTACCTCTGG - Intergenic
1102809270 12:115809864-115809886 GAACCTAGTTTGTCTGCCTCTGG - Intergenic
1103562154 12:121798358-121798380 GAAGCACGTGTCCCTGCCTCAGG - Intronic
1103733299 12:123042780-123042802 GAGCCTTGTCTGGCTGCATCTGG - Intronic
1103900032 12:124298681-124298703 GAACTATGTGTGGCAGCAGCAGG + Intronic
1104356640 12:128092618-128092640 GGCCCATATTTGGCTGCCTCTGG - Intergenic
1104892326 12:132146178-132146200 GATCCAGGAGTGGCTGCCTGGGG - Intronic
1106575679 13:30972408-30972430 GAACCATGTATGTATACCTCTGG + Intronic
1106895064 13:34291081-34291103 GAACCTTGTGTGGCTTTATCAGG - Intergenic
1113037072 13:106062148-106062170 TTACCATTTGTTGCTGCCTCTGG - Intergenic
1113523279 13:110955254-110955276 GGAGCATGTGTGGCTTTCTCTGG - Intergenic
1113702027 13:112395242-112395264 GGAGCATGTGTGGCTTTCTCTGG + Intronic
1113718027 13:112528030-112528052 GACCCCTGTGTGGCTCCCCCAGG + Intronic
1116998447 14:51347910-51347932 GAAGCATGGGTGGAGGCCTCAGG - Intergenic
1119670174 14:76512499-76512521 GAACCATGACTGGCCACCTCTGG - Intergenic
1121257636 14:92542900-92542922 GAAAGATGAGTGGTTGCCTCGGG + Intronic
1121262920 14:92579694-92579716 GAAACATGTGTGCCTGGCACTGG + Intronic
1121324629 14:93012846-93012868 GGGCCATGTGGGGCTGCCTCGGG - Intronic
1122016666 14:98802403-98802425 TAAATATGTGTGGATGCCTCTGG - Intergenic
1122030003 14:98905269-98905291 GAACCATGTGAGGCTCACTCAGG - Intergenic
1122833909 14:104421689-104421711 GATCCATGTGGGCCTGGCTCTGG - Intergenic
1125406950 15:39362699-39362721 GAATCTTGTGTGGCTGCCCAGGG - Intergenic
1125424920 15:39539058-39539080 GAAACAGCTGTGGCTGACTCAGG - Intergenic
1127982505 15:64045511-64045533 GCACCATAGCTGGCTGCCTCGGG - Intronic
1129105416 15:73304039-73304061 GAAAGATGTGTGGAAGCCTCAGG - Exonic
1132018240 15:98337981-98338003 GCACCAAGTTTGGATGCCTCAGG - Intergenic
1133323605 16:4930236-4930258 GAAGCCTGTGTGGCTGGGTCAGG + Intronic
1135522625 16:23189146-23189168 GACCCATGTGTGACTTCCTGTGG - Intronic
1138313568 16:56049273-56049295 GAACCCTTTGTCGCTGCCTCAGG - Intergenic
1141410247 16:83828241-83828263 GACCCATGTGAGGCAGACTCGGG + Intergenic
1142135290 16:88449215-88449237 GAGCCATGTGTCGTAGCCTCAGG - Intergenic
1143881742 17:10035234-10035256 GACCAAGGTGTGGCTGCCTTGGG - Intronic
1145201026 17:20944800-20944822 GCACCACGTGTGGCTGCTGCCGG + Intergenic
1149432629 17:56606434-56606456 GAACCATATCTGGCTACCTCTGG + Intergenic
1152038347 17:77887261-77887283 AAACACTGTGTGGCTGCCTTGGG - Intergenic
1152407434 17:80105642-80105664 CATCCATGTGTGGCTGCACCAGG + Intergenic
1152754519 17:82081691-82081713 GGACCATGTGGGGCTGGTTCAGG + Exonic
1157651457 18:49336552-49336574 GAACCATGTGTGTCTTCCGTAGG + Intronic
1163240598 19:16060891-16060913 GAACCAAGAGTGGCTGACTCCGG - Intergenic
1167034693 19:46988205-46988227 AGACCATGTGTGGCTGCAGCGGG + Intronic
1168694658 19:58397466-58397488 GATCCGTGTGGGGCTGCCCCTGG - Intergenic
925211061 2:2046637-2046659 GAACCAAGTGTGGCTTCACCCGG - Intronic
925766232 2:7238356-7238378 GATTCATGAGTGGCTGCTTCTGG + Intergenic
927487921 2:23501905-23501927 AAACCATCAGTGGCTGCTTCTGG - Intronic
927691580 2:25212254-25212276 AAACCATGTGTAACGGCCTCTGG + Intergenic
929084002 2:38149623-38149645 GAACCATGTCTTACTGGCTCAGG - Intergenic
930344915 2:50168108-50168130 GAAGGATGTGTCTCTGCCTCAGG + Intronic
930845207 2:55895959-55895981 GCACCTTGTCTGGCTGGCTCAGG + Intronic
931442795 2:62303270-62303292 TTTCCATGTGTGGTTGCCTCTGG + Intergenic
932831673 2:74996347-74996369 GGACCATCTGTGGCTTCCTCTGG + Intergenic
932892129 2:75606537-75606559 GAAGGAGGTGTGGATGCCTCAGG - Intergenic
934527398 2:95060120-95060142 GAACCATGGGTGGGGCCCTCAGG - Intergenic
935595459 2:104874001-104874023 GAAGCAGGTGCGCCTGCCTCGGG - Intergenic
937050664 2:118885892-118885914 GAAACATGTTTGGCTACATCAGG - Intergenic
940525281 2:154806752-154806774 CAACCATGTCTGCCTTCCTCAGG + Intronic
941382771 2:164816194-164816216 GAAAAATGTGTGGATTCCTCTGG + Intronic
945279815 2:208025581-208025603 GAACCTTGTGTGTCCGGCTCTGG - Intergenic
946364432 2:219239951-219239973 GACTCAAGTGTGGCTCCCTCCGG - Exonic
946565013 2:220954728-220954750 GAACCATGTGTGAGTGACTCTGG - Intergenic
948690447 2:239699152-239699174 TCATCATGTGTGGCTGCCTATGG + Intergenic
948857590 2:240737216-240737238 GGACCCTGGGGGGCTGCCTCAGG + Intronic
1169204839 20:3733618-3733640 GGACCATGTGTGGCTGAGTGAGG - Intronic
1170635306 20:18099224-18099246 GAAAAAGGTGTGGCAGCCTCAGG - Intergenic
1171374723 20:24684825-24684847 GTGCCACGTGTGGCTTCCTCAGG + Intergenic
1173175751 20:40763531-40763553 GCCCAATGTGTGGCTGGCTCAGG - Intergenic
1174360670 20:50027312-50027334 GAACCACGTGTGTCTTTCTCAGG + Intergenic
1174362336 20:50036889-50036911 GAACCCAGTCTGGCTGACTCTGG - Intergenic
1179078293 21:38144398-38144420 GAATCAGGTGTAGCTGCCTAAGG - Intronic
1179481565 21:41681906-41681928 GAACCATGTGAAGGTGGCTCTGG - Intergenic
1183480923 22:38065156-38065178 GAAACATGTGTTGCTGCCTCTGG - Intronic
1184377716 22:44124956-44124978 GCAGCATCTGTAGCTGCCTCTGG + Intronic
949953332 3:9247631-9247653 GAAGCAGGTGTGGCAACCTCAGG + Intronic
950123707 3:10498608-10498630 GGGCCATGTCTGGCTGCCCCGGG - Intronic
950471547 3:13189543-13189565 GAAGCTTGTGGGGTTGCCTCTGG - Intergenic
952072366 3:29653468-29653490 GAACCATGTTTAACTGCCTAAGG + Intronic
955346813 3:58167680-58167702 GAACCATGTCTGCATGGCTCTGG - Intronic
958534851 3:95387398-95387420 GAGTGATGTGTGGCTGCCCCAGG + Intergenic
962314228 3:134349036-134349058 GACCCATGTGTGCCTGCCTGAGG + Intergenic
965490222 3:169325929-169325951 CAACCCTGTGTGCCTGCCACTGG + Intronic
966050206 3:175606867-175606889 GCAGCATGTGTGGCTGTCTGTGG + Intronic
966852341 3:184171787-184171809 GCACCACGTGTGGCAGCCTGCGG + Exonic
968941444 4:3640791-3640813 GAGCCACGTGTGGGTGACTCAGG - Intergenic
969061393 4:4438093-4438115 GAGCCCTGTGTGCCGGCCTCAGG - Intronic
969126156 4:4949724-4949746 TAAGCATGTGTGACTGCCCCAGG - Intergenic
969959084 4:10924754-10924776 AAACTGTGTGTGGCTGTCTCAGG - Intergenic
970093032 4:12431011-12431033 CACCCACTTGTGGCTGCCTCAGG - Intergenic
970716384 4:18930541-18930563 GTGCCATGTCTGGCTGCCTTCGG - Intergenic
975536845 4:75460075-75460097 GAACCAAGTGTGGCTTCTTTAGG - Intergenic
976773515 4:88681354-88681376 GAAACTGTTGTGGCTGCCTCTGG + Intronic
977797952 4:101191439-101191461 AAATGATGTGTGGCTGCCACAGG + Intronic
980040803 4:127937526-127937548 GAACATTGTGTGGATGACTCAGG - Intronic
980704499 4:136475187-136475209 TAACCCTGGGGGGCTGCCTCTGG - Intergenic
981966936 4:150615128-150615150 TCACCAAGTGTGTCTGCCTCAGG - Intronic
984235176 4:177148022-177148044 GATCCATGTGTGTATGCATCTGG - Intergenic
984626156 4:182009708-182009730 GCACCAGCTGTGGCTGCCTGGGG - Intergenic
985792148 5:1935001-1935023 AAAACAAGAGTGGCTGCCTCTGG - Intergenic
986062360 5:4203325-4203347 GCACCCTGTGAGTCTGCCTCTGG - Intergenic
988460356 5:31430616-31430638 GAATCATGTCTGGCTGGTTCTGG + Intronic
989108972 5:37889065-37889087 CAACCTGCTGTGGCTGCCTCTGG + Intergenic
989792300 5:45420431-45420453 GAAACATGTAAGGCTGTCTCAGG + Intronic
990712778 5:58604157-58604179 GAACCATCTGTGGGTCTCTCAGG + Intronic
996971363 5:129372261-129372283 AAAGGATGTGTGACTGCCTCAGG + Intergenic
998373029 5:141673174-141673196 GAGCCATGTGTGCCAGCCCCTGG + Intronic
999585680 5:153087354-153087376 TAACCATGTGTGGGTTACTCTGG - Intergenic
1001586276 5:172835210-172835232 ACACCAAGTGTGGCTGCCTCAGG - Intronic
1002679235 5:180948393-180948415 GAACCATGTGTGGGAGGCTCAGG - Intronic
1002685110 5:181003890-181003912 GAACCATGTGTGGGAGGCTCAGG - Intronic
1002906628 6:1454336-1454358 GAACCATCTGTGGCAACCACAGG + Intergenic
1004838413 6:19555038-19555060 GAACCATGTGTAGGTACCTGTGG + Intergenic
1004891793 6:20108002-20108024 GAAGCATGTGGGGCTGCCCTAGG + Intronic
1005369201 6:25112944-25112966 GGACCATCTATGGCTGCCTTTGG + Intergenic
1007253397 6:40511719-40511741 GAACCAGGTGTGGGTGCCGATGG + Intronic
1010092587 6:72002568-72002590 GAAGCATGCGTGGCAGCCTGAGG + Intronic
1012389097 6:98716699-98716721 GTAGCATGTTTGGCTGCCACAGG - Intergenic
1012705588 6:102524679-102524701 GAAACCTCAGTGGCTGCCTCAGG + Intergenic
1014670517 6:124298924-124298946 TAACCATGTGTGGCAGCTTGTGG + Intronic
1017521306 6:155205645-155205667 GAACCATACGTAGCTGCCTGAGG + Intronic
1019175461 6:170157187-170157209 GGACCATGTGTGCCAGGCTCTGG - Intergenic
1022127525 7:27372641-27372663 ATCCCATGGGTGGCTGCCTCAGG - Intergenic
1023835538 7:44065286-44065308 GGACCAGATGTGGCTGCCTGTGG - Exonic
1027580814 7:79992986-79993008 GAACAATGTGTGGCTGGTCCAGG - Intergenic
1029242980 7:99177672-99177694 GGAGCTTGTCTGGCTGCCTCTGG - Intronic
1032794041 7:135263421-135263443 GAACCATGTGAGGCTGTGGCTGG + Intergenic
1034313487 7:150110426-150110448 GAAGCAGGTGGGGCTGCCTGAGG + Intergenic
1034793373 7:153990238-153990260 GAAGCAGGTGGGGCTGCCTGAGG - Intronic
1035592346 8:825425-825447 GAAGGAAGTGCGGCTGCCTCCGG - Intergenic
1037804804 8:22053343-22053365 GAGCCATGTGCCCCTGCCTCCGG - Intronic
1037817584 8:22120227-22120249 GAAGCAGGTGTTGCTGCCGCCGG - Intronic
1039012659 8:33111638-33111660 AAACCAAGTGGGGCTGCCTAAGG - Intergenic
1039404594 8:37301665-37301687 GATCCATGTGTGCCTCCCACTGG - Intergenic
1041720058 8:60967603-60967625 GAACCATGTGTGGCTGCCTCTGG + Intergenic
1041812583 8:61927892-61927914 TATCCCTGTGTGGCTGCCTCTGG + Intergenic
1044479776 8:92671903-92671925 GAATCATGTGTGGCTGGGTGTGG + Intergenic
1044533843 8:93337745-93337767 GAGCCAGGTGGGGCTGCCTCTGG - Intergenic
1044825806 8:96195700-96195722 GAACCATCTTTGGCTCCCTGAGG + Intergenic
1048920242 8:139222858-139222880 GAACCATGTGGGACTGGATCAGG + Intergenic
1049223391 8:141438116-141438138 GAACCAGGTGTGGCTGGGGCAGG - Intergenic
1050313406 9:4376193-4376215 GAACCATTTGTCTCTGCTTCAGG - Intergenic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1057769963 9:97958702-97958724 GACCCATCTGTGGCTAACTCTGG - Intergenic
1057825767 9:98371103-98371125 GAACCATCCGTGGCAGCCTGGGG - Intronic
1058917945 9:109585782-109585804 GAACCATGTGCTTCTGCTTCTGG + Intergenic
1059208703 9:112490330-112490352 GAAACCTGTGGGGCTTCCTCAGG - Intronic
1059382375 9:113936194-113936216 GACCCAGGTCTGTCTGCCTCTGG - Intronic
1060370800 9:123069202-123069224 AAACCATTTGTGGGTTCCTCTGG - Intronic
1060591239 9:124818260-124818282 GAGCCAAGGGTGGCTGGCTCAGG - Intergenic
1060656371 9:125375113-125375135 GAACCTGGTGTGTCTGCCTCGGG - Intergenic
1061175508 9:128993688-128993710 GAACCAAGTAAGTCTGCCTCTGG + Exonic
1062074626 9:134578911-134578933 GAACCAACTGTTGCTGCCACAGG + Intergenic
1192585443 X:72315053-72315075 GAACCAGGTGCTGCTTCCTCTGG + Intergenic
1193731476 X:85108401-85108423 GACTCATGTTTGGTTGCCTCAGG + Exonic
1194342535 X:92722313-92722335 GACCCATTTGTAGCTCCCTCAGG - Intergenic
1200069781 X:153522474-153522496 CAGCCATGTGTGGCTACCTGAGG - Intronic
1200650898 Y:5839002-5839024 GACCCATTTGTAGCTCCCTCAGG - Intergenic