ID: 1041721084

View in Genome Browser
Species Human (GRCh38)
Location 8:60975951-60975973
Sequence TACAATAAGTACAAGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041721078_1041721084 17 Left 1041721078 8:60975911-60975933 CCACAAGCCACCAGGAGCCAAGA No data
Right 1041721084 8:60975951-60975973 TACAATAAGTACAAGGAGGCCGG No data
1041721079_1041721084 10 Left 1041721079 8:60975918-60975940 CCACCAGGAGCCAAGAGCTAAGT No data
Right 1041721084 8:60975951-60975973 TACAATAAGTACAAGGAGGCCGG No data
1041721081_1041721084 0 Left 1041721081 8:60975928-60975950 CCAAGAGCTAAGTGAAGAGTACA No data
Right 1041721084 8:60975951-60975973 TACAATAAGTACAAGGAGGCCGG No data
1041721080_1041721084 7 Left 1041721080 8:60975921-60975943 CCAGGAGCCAAGAGCTAAGTGAA No data
Right 1041721084 8:60975951-60975973 TACAATAAGTACAAGGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041721084 Original CRISPR TACAATAAGTACAAGGAGGC CGG Intergenic
No off target data available for this crispr