ID: 1041721170

View in Genome Browser
Species Human (GRCh38)
Location 8:60976821-60976843
Sequence GTTTCTATTGCCCCACTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041721170_1041721174 -3 Left 1041721170 8:60976821-60976843 CCGCCCAGTGGGGCAATAGAAAC No data
Right 1041721174 8:60976841-60976863 AACTTTATCCTCCAAAAATTGGG No data
1041721170_1041721175 -2 Left 1041721170 8:60976821-60976843 CCGCCCAGTGGGGCAATAGAAAC No data
Right 1041721175 8:60976842-60976864 ACTTTATCCTCCAAAAATTGGGG No data
1041721170_1041721173 -4 Left 1041721170 8:60976821-60976843 CCGCCCAGTGGGGCAATAGAAAC No data
Right 1041721173 8:60976840-60976862 AAACTTTATCCTCCAAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041721170 Original CRISPR GTTTCTATTGCCCCACTGGG CGG (reversed) Intergenic
No off target data available for this crispr