ID: 1041723609

View in Genome Browser
Species Human (GRCh38)
Location 8:60998397-60998419
Sequence CTTCATATGAAACTTAAGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041723609_1041723615 -1 Left 1041723609 8:60998397-60998419 CCCGACTTAAGTTTCATATGAAG No data
Right 1041723615 8:60998419-60998441 GTGTTTGCCCTGGTGGTGAGGGG No data
1041723609_1041723617 5 Left 1041723609 8:60998397-60998419 CCCGACTTAAGTTTCATATGAAG No data
Right 1041723617 8:60998425-60998447 GCCCTGGTGGTGAGGGGTAAGGG No data
1041723609_1041723616 4 Left 1041723609 8:60998397-60998419 CCCGACTTAAGTTTCATATGAAG No data
Right 1041723616 8:60998424-60998446 TGCCCTGGTGGTGAGGGGTAAGG No data
1041723609_1041723623 15 Left 1041723609 8:60998397-60998419 CCCGACTTAAGTTTCATATGAAG No data
Right 1041723623 8:60998435-60998457 TGAGGGGTAAGGGGTGAGGGTGG No data
1041723609_1041723624 16 Left 1041723609 8:60998397-60998419 CCCGACTTAAGTTTCATATGAAG No data
Right 1041723624 8:60998436-60998458 GAGGGGTAAGGGGTGAGGGTGGG No data
1041723609_1041723614 -2 Left 1041723609 8:60998397-60998419 CCCGACTTAAGTTTCATATGAAG No data
Right 1041723614 8:60998418-60998440 AGTGTTTGCCCTGGTGGTGAGGG No data
1041723609_1041723621 11 Left 1041723609 8:60998397-60998419 CCCGACTTAAGTTTCATATGAAG No data
Right 1041723621 8:60998431-60998453 GTGGTGAGGGGTAAGGGGTGAGG No data
1041723609_1041723619 6 Left 1041723609 8:60998397-60998419 CCCGACTTAAGTTTCATATGAAG No data
Right 1041723619 8:60998426-60998448 CCCTGGTGGTGAGGGGTAAGGGG No data
1041723609_1041723625 17 Left 1041723609 8:60998397-60998419 CCCGACTTAAGTTTCATATGAAG No data
Right 1041723625 8:60998437-60998459 AGGGGTAAGGGGTGAGGGTGGGG No data
1041723609_1041723612 -8 Left 1041723609 8:60998397-60998419 CCCGACTTAAGTTTCATATGAAG No data
Right 1041723612 8:60998412-60998434 ATATGAAGTGTTTGCCCTGGTGG No data
1041723609_1041723622 12 Left 1041723609 8:60998397-60998419 CCCGACTTAAGTTTCATATGAAG No data
Right 1041723622 8:60998432-60998454 TGGTGAGGGGTAAGGGGTGAGGG No data
1041723609_1041723626 18 Left 1041723609 8:60998397-60998419 CCCGACTTAAGTTTCATATGAAG No data
Right 1041723626 8:60998438-60998460 GGGGTAAGGGGTGAGGGTGGGGG No data
1041723609_1041723613 -3 Left 1041723609 8:60998397-60998419 CCCGACTTAAGTTTCATATGAAG No data
Right 1041723613 8:60998417-60998439 AAGTGTTTGCCCTGGTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041723609 Original CRISPR CTTCATATGAAACTTAAGTC GGG (reversed) Intergenic
No off target data available for this crispr