ID: 1041724250

View in Genome Browser
Species Human (GRCh38)
Location 8:61003550-61003572
Sequence TTGTTAGTCACAGAATTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041724249_1041724250 8 Left 1041724249 8:61003519-61003541 CCACTGCAAGGATAACTGGCAAT No data
Right 1041724250 8:61003550-61003572 TTGTTAGTCACAGAATTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041724250 Original CRISPR TTGTTAGTCACAGAATTTGA TGG Intergenic
No off target data available for this crispr