ID: 1041725134

View in Genome Browser
Species Human (GRCh38)
Location 8:61011139-61011161
Sequence TACCGTAGTCCAGCTACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041725130_1041725134 18 Left 1041725130 8:61011098-61011120 CCTTTCTACTTCTTCATGGTTTT No data
Right 1041725134 8:61011139-61011161 TACCGTAGTCCAGCTACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041725134 Original CRISPR TACCGTAGTCCAGCTACTGG GGG Intergenic
No off target data available for this crispr