ID: 1041725887

View in Genome Browser
Species Human (GRCh38)
Location 8:61017066-61017088
Sequence CTGTCTTTTTGGAGAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041725887_1041725893 0 Left 1041725887 8:61017066-61017088 CCTGCTTCTCTCCAAAAAGACAG No data
Right 1041725893 8:61017089-61017111 CCGGGGCTTCGCATCACATTAGG No data
1041725887_1041725895 6 Left 1041725887 8:61017066-61017088 CCTGCTTCTCTCCAAAAAGACAG No data
Right 1041725895 8:61017095-61017117 CTTCGCATCACATTAGGCCAGGG No data
1041725887_1041725899 18 Left 1041725887 8:61017066-61017088 CCTGCTTCTCTCCAAAAAGACAG No data
Right 1041725899 8:61017107-61017129 TTAGGCCAGGGCTGCACTGGGGG No data
1041725887_1041725897 16 Left 1041725887 8:61017066-61017088 CCTGCTTCTCTCCAAAAAGACAG No data
Right 1041725897 8:61017105-61017127 CATTAGGCCAGGGCTGCACTGGG No data
1041725887_1041725898 17 Left 1041725887 8:61017066-61017088 CCTGCTTCTCTCCAAAAAGACAG No data
Right 1041725898 8:61017106-61017128 ATTAGGCCAGGGCTGCACTGGGG No data
1041725887_1041725896 15 Left 1041725887 8:61017066-61017088 CCTGCTTCTCTCCAAAAAGACAG No data
Right 1041725896 8:61017104-61017126 ACATTAGGCCAGGGCTGCACTGG No data
1041725887_1041725894 5 Left 1041725887 8:61017066-61017088 CCTGCTTCTCTCCAAAAAGACAG No data
Right 1041725894 8:61017094-61017116 GCTTCGCATCACATTAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041725887 Original CRISPR CTGTCTTTTTGGAGAGAAGC AGG (reversed) Intergenic
No off target data available for this crispr