ID: 1041731652

View in Genome Browser
Species Human (GRCh38)
Location 8:61068937-61068959
Sequence CACTGTGGAAGAGGGACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 312}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041731652_1041731658 30 Left 1041731652 8:61068937-61068959 CCATTTGTCCCTCTTCCACAGTG 0: 1
1: 0
2: 2
3: 18
4: 312
Right 1041731658 8:61068990-61069012 GAGTTTCATTCTTGTTGTCCAGG 0: 31
1: 1279
2: 13950
3: 23930
4: 28961
1041731652_1041731657 8 Left 1041731652 8:61068937-61068959 CCATTTGTCCCTCTTCCACAGTG 0: 1
1: 0
2: 2
3: 18
4: 312
Right 1041731657 8:61068968-61068990 GGAATTCTTTTTTTTTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041731652 Original CRISPR CACTGTGGAAGAGGGACAAA TGG (reversed) Intronic
900791702 1:4684983-4685005 CACTGTGGCAGGAGGAAAAAAGG + Intronic
901293508 1:8142913-8142935 CACTGTACAAGATGTACAAATGG - Intergenic
901350201 1:8588768-8588790 CACTATGGAAGATGTCCAAAGGG - Intronic
901872642 1:12147051-12147073 CACGGTGGGCGAGGGAAAAAAGG + Intergenic
903408221 1:23117130-23117152 GAGTGTGGAATAGAGACAAAGGG - Intronic
905297578 1:36963908-36963930 CCCTGGGGATGATGGACAAATGG - Intronic
905395729 1:37665216-37665238 CACTGTGGAAGAAGCAGACAGGG - Intergenic
905805530 1:40874273-40874295 CCCTGTGGAAGAGGGAGATTAGG + Intergenic
906002879 1:42442232-42442254 CAATGTGGAGGAGGGACCAGAGG + Intronic
907793857 1:57694754-57694776 CACTGTTGAAGATGGATAATGGG - Intronic
907826933 1:58026956-58026978 CTCTGTGGTAGAAGGACAAATGG + Intronic
907836281 1:58112025-58112047 CACTGGGGGATAGGGAGAAAGGG - Intronic
908690666 1:66775849-66775871 CACTGTGGTAGCGGGAGAAGGGG + Intronic
911789837 1:102000424-102000446 GACTGAGGAAGAGGAAGAAAAGG + Intergenic
912079707 1:105919986-105920008 CACTGTAGAAGAGTGTCCAAAGG + Intergenic
912641868 1:111353971-111353993 CACCGTGGAAGAGGAAAGAAGGG - Intergenic
913457688 1:119050128-119050150 GGCTGGAGAAGAGGGACAAAGGG - Intronic
914091590 1:144504910-144504932 AACTATGGAAGACCGACAAATGG + Intergenic
914256686 1:145965813-145965835 CACTGTAAAAGAGGGAAATATGG + Intronic
914307010 1:146429265-146429287 AACTATGGAAGACCGACAAATGG - Intergenic
914595096 1:149143847-149143869 AACTATGGAAGACCGACAAATGG + Intergenic
915893752 1:159795016-159795038 CTCTGTGCAAGATGGAAAAAAGG + Intergenic
916778373 1:167994458-167994480 AACTGTGAAAGAGGCACAATTGG - Intronic
919342999 1:196337573-196337595 CACTGTGTTTGAGGCACAAAGGG + Intronic
921315447 1:213886176-213886198 CACTGTGGAAGGCTGAAAAATGG - Intergenic
922504577 1:226119091-226119113 GAAGGTGGAAGAGAGACAAAGGG + Intergenic
923329144 1:232906605-232906627 CACTGTGAGGAAGGGACAAAGGG - Intergenic
923596954 1:235367759-235367781 CACTTTGGAAGAGGTGAAAATGG + Intronic
924302446 1:242652810-242652832 AACTGTGGAAGTGGGAAAGAGGG - Intergenic
924511725 1:244733383-244733405 CACAGTTGAAGAGGGCCAAATGG - Intergenic
1063147013 10:3304776-3304798 GACTGGGGAAGAGAGAGAAAAGG + Intergenic
1063661018 10:8035044-8035066 CTCTGAGGAAGTGGGACAAAAGG + Intergenic
1064222691 10:13455421-13455443 CATTGCAGAAGAGGGACAGAAGG + Intronic
1064666236 10:17654731-17654753 CAGTTTGGAAGAGGGAAAAGAGG - Intronic
1065858974 10:29854848-29854870 CAGTATGGAAGAAGGAGAAAGGG - Intergenic
1066227435 10:33397166-33397188 AACTGTGGGAGTGGGAAAAAGGG + Intergenic
1066654730 10:37687085-37687107 CACTGTCAGGGAGGGACAAATGG + Intergenic
1067478923 10:46583137-46583159 CTCTGTGGAAAAGGGAGAAGGGG + Intronic
1067615815 10:47758664-47758686 CTCTGTGGAAAAGGGAGAAGGGG - Intergenic
1068880777 10:62046645-62046667 CACTGAGTAAGAGGAACAGATGG + Intronic
1070519915 10:77243757-77243779 CACTGTGGAAGGGTAACACAGGG - Intronic
1070824533 10:79383074-79383096 CTCAGTGGAAGAGGCACAAAGGG + Exonic
1071070173 10:81682428-81682450 CACTGGAGAATAGTGACAAATGG + Intergenic
1072240347 10:93489965-93489987 CACTCTGGAAAAGTAACAAAAGG + Intergenic
1074577093 10:114680541-114680563 CAGTGTGGAAGGGGCAGAAATGG + Intronic
1074678788 10:115882184-115882206 CTCTGGGGAAGAGCCACAAAAGG + Intronic
1074908566 10:117886663-117886685 CTGTGTGGAAGAAGGAAAAAAGG - Intergenic
1075040384 10:119103488-119103510 CACTGGGGAAGACAGACAATTGG - Intergenic
1075741790 10:124700489-124700511 CACGGTGGGAGAAGCACAAAGGG - Intronic
1076133969 10:128031909-128031931 CTCTGTTGAAGAGGGAAATACGG - Intronic
1076544278 10:131234006-131234028 CAATGTGGCAGAAGGTCAAAGGG - Intronic
1076704910 10:132295996-132296018 CAGTGTGGAAAAGGGGGAAAGGG + Intronic
1080149739 11:29037062-29037084 CACTGAGGAGGAGGAAGAAAAGG - Intergenic
1080491501 11:32769380-32769402 CACTGTGGTACAAGGACAACTGG + Intronic
1082128652 11:48461026-48461048 AACTGTGGTAGAGGGAAGAAAGG + Intergenic
1082680257 11:56159122-56159144 CAGTGTGGGCGAGGGATAAAAGG + Intergenic
1083823491 11:65185307-65185329 GACTATGGAAGGGGGAGAAAAGG + Intronic
1084431509 11:69113998-69114020 CACTGTGGCCGAGGGATAGACGG + Intergenic
1085292854 11:75412379-75412401 CACTGTGGAAGTAGGAAAGATGG - Intronic
1085980508 11:81718503-81718525 CACTGCTGAAAAGGGTCAAAGGG - Intergenic
1086568620 11:88256948-88256970 CACTGTGGAAGCTGGAACAACGG + Intergenic
1086820108 11:91425409-91425431 TACTGAGGAAGAGGGACAAAGGG - Intergenic
1087276372 11:96164418-96164440 CACTGTGTGATAGGGAAAAAAGG - Intronic
1088088561 11:106010473-106010495 CAAGGTGGAAGAGGAAGAAAGGG - Exonic
1088316465 11:108511921-108511943 CACTGAGAAAGAGGGTAAAATGG - Exonic
1092004001 12:5053788-5053810 CACTGGACAAGAGGGACTAAGGG - Intergenic
1093246078 12:16738501-16738523 CACTGCGGAAGAAGGACCTAGGG - Intergenic
1094011135 12:25811009-25811031 CACTGTTTATGATGGACAAAAGG - Intergenic
1095277582 12:40306580-40306602 AACTGTGGAAAAGGGAGCAAAGG - Intronic
1099729024 12:86474011-86474033 TACTTTGGAAGAGGGTCAGAGGG - Intronic
1099832119 12:87857469-87857491 CACTGTGGGAGAGGGAGGAAGGG - Intergenic
1100477535 12:94948423-94948445 CACTGAGCTAGAAGGACAAAAGG + Intronic
1101032342 12:100672495-100672517 CCCTGGGGTAGAGGGAGAAAGGG + Intergenic
1102002795 12:109568153-109568175 CATTGTGGCAGAGGGAAAAGAGG - Intronic
1102191669 12:110993380-110993402 CTCTGGGGAAAAGGGACAAAGGG + Intergenic
1106292060 13:28372935-28372957 CACTGAGAAAGAGGTAAAAAGGG - Intronic
1107880864 13:44830843-44830865 CACTGTGGCAGAGAGAGTAAGGG - Intergenic
1108145499 13:47472386-47472408 CACATTGGCATAGGGACAAAGGG - Intergenic
1108648388 13:52452117-52452139 CACAGGGGCAGAGGGACAGAGGG + Intergenic
1110077800 13:71271422-71271444 CACAGTGAATGAAGGACAAAAGG - Intergenic
1110085116 13:71368496-71368518 TACTGTGGTAGAGAGACAGATGG + Intergenic
1112706721 13:102078612-102078634 CACTATGGAAGATGAACAGAGGG + Intronic
1114267732 14:21082535-21082557 TACTGAGAAAGAGGGACAGATGG - Intronic
1116674009 14:47881410-47881432 CACTTCTAAAGAGGGACAAAGGG - Intergenic
1117483456 14:56171556-56171578 CACAGTGTAACAGGGACACACGG - Intronic
1117775989 14:59185118-59185140 CGCTAGGCAAGAGGGACAAAGGG + Intergenic
1118605464 14:67499820-67499842 CACTGCTAAACAGGGACAAAGGG + Intronic
1119162660 14:72465915-72465937 CACTGTCTGAAAGGGACAAAAGG - Intronic
1121697427 14:95925175-95925197 CATTGTAGAAGAAGGAAAAAGGG + Intergenic
1124099635 15:26681493-26681515 CCCGTTGGAGGAGGGACAAAGGG - Intronic
1125289439 15:38129773-38129795 CATTGTGGAAGTGGGACAAAGGG + Intergenic
1125598563 15:40903008-40903030 CACAGAGGAAGAGGTAAAAAGGG - Exonic
1125748752 15:42014673-42014695 CCCTGGGGAAGAGGCCCAAAGGG - Intronic
1126320686 15:47419539-47419561 TATTGAGGAAGAAGGACAAAAGG + Intronic
1126408459 15:48347299-48347321 CATTGAGGAAGAGGGAAATATGG - Intergenic
1127331108 15:57940745-57940767 CTCTCAGGAAGAGGAACAAAAGG - Intergenic
1127507905 15:59612638-59612660 CACTTGGCAAGAGGGAGAAAGGG - Intronic
1129688692 15:77700960-77700982 CACCATGGAAGAGGGACCAGGGG + Intronic
1131122298 15:89830181-89830203 CGCTGTGGCCGAGGGACAAGAGG - Intergenic
1131469659 15:92684952-92684974 GACTGTGGAAAGGGGACAGAGGG - Intronic
1132363522 15:101238012-101238034 CTCTGCGGAAGAGGTACACAAGG + Intronic
1132462095 16:60538-60560 GACTGTGGGAGGGGGACACAGGG + Exonic
1134089404 16:11383644-11383666 CACTGTGGAGGAGGGGCCAGGGG + Exonic
1135491208 16:22911390-22911412 GACTGTGGAAAAGGTAGAAAGGG + Intronic
1135762908 16:25151871-25151893 CACTTTGAAGGAGGGGCAAAAGG + Intronic
1136229241 16:28877242-28877264 CAGTGGGGAAGAGGGACAGCAGG - Intergenic
1137906930 16:52332681-52332703 CCCACTGAAAGAGGGACAAATGG - Intergenic
1138318810 16:56093515-56093537 CACTCTGGAAGAGAGAGAATGGG + Intergenic
1138522909 16:57581817-57581839 CAATGTGGAAGAAGGCCAAGTGG + Intronic
1140472805 16:75224684-75224706 CCCTGTGGGAGAGGGAGAAGGGG - Exonic
1143274714 17:5701534-5701556 CTCTGTGGCAGAATGACAAATGG + Intergenic
1143770695 17:9166736-9166758 CACAGGGGAACAGGGACAAAGGG + Intronic
1144079119 17:11746345-11746367 CACTGTGCAAGGAAGACAAAGGG - Intronic
1144784248 17:17823168-17823190 CGCTGTGGCAGAGGGACAACGGG + Intronic
1146281644 17:31549142-31549164 GACTGGGGATGGGGGACAAAGGG - Intergenic
1147723082 17:42550521-42550543 CACTGTCACAGAGGGGCAAAGGG - Exonic
1147724294 17:42556747-42556769 CACTGTCACAGAGGGGCAAAGGG - Intergenic
1147865953 17:43552467-43552489 TTCTGTTGAAGAGAGACAAACGG + Intronic
1148352297 17:46949866-46949888 CAGTGTGGAGGAGGGAAGAAAGG + Intronic
1150266968 17:63838136-63838158 CTCTGTGGCCGAGGGAGAAAGGG + Intronic
1151339265 17:73459256-73459278 CAGTGTGTAAGATGGACAGAAGG - Intronic
1152354328 17:79799332-79799354 CACTGTGGAAGTGGGAGGGAGGG + Intronic
1153413095 18:4815985-4816007 CAGTGTGGAAGAGGACCAGAGGG - Intergenic
1162192610 19:8958977-8958999 CACTGGGGAAGAAGGAGAACTGG + Exonic
1163588454 19:18176803-18176825 CACTGTGGAAGGAGGATGAAGGG + Intronic
1165446626 19:35860331-35860353 CACTGTGCAGGAGGGAGAGAAGG + Exonic
1167619519 19:50553004-50553026 CACTGTGAAACAGGGATAATGGG + Intronic
1167747952 19:51363891-51363913 CACAGTGGCAGAAGCACAAAGGG + Intronic
925604373 2:5643419-5643441 AACTATGGAAGACAGACAAATGG - Intergenic
925753783 2:7113696-7113718 AACTGTAGAAGAGGGAAAACAGG - Intergenic
927407784 2:22791747-22791769 CAGTGAGGAAGAGGTAGAAAGGG - Intergenic
928762515 2:34601431-34601453 CTGTGGGGAAGAGGGACAAGGGG + Intergenic
930420735 2:51150949-51150971 CACTGTGGAAGAAGATCCAAGGG + Intergenic
930691290 2:54368369-54368391 CACTGAGCTAGAAGGACAAAAGG + Intronic
931047259 2:58369253-58369275 AACTGTGGAAGAGGGGCACAAGG - Intergenic
931242323 2:60464228-60464250 TAATGTGGAAGGGGGAAAAAAGG + Intronic
932466907 2:71929947-71929969 CCCTGTGGAGGAGGGGCTAAAGG + Intergenic
932728546 2:74200192-74200214 CACTCAGGAAGAGGGAGAAGGGG - Intronic
934527254 2:95059509-95059531 CACTGAGGCAGAGGGAGAGACGG + Intergenic
935266470 2:101399104-101399126 GAATGTAGAAGAGGGACAGATGG + Intronic
936096047 2:109530962-109530984 GACTCTGGAAGAGGGAAAGAGGG + Intergenic
936381222 2:111988218-111988240 CAGTGAGAAAGAGGGAGAAAAGG - Intronic
936589291 2:113787848-113787870 CACTTTAGAAAAGTGACAAATGG - Intergenic
936771773 2:115922300-115922322 GTGTGTGGAAGAGGGATAAAAGG + Intergenic
937545540 2:123013805-123013827 CACAGTGGAAGAAGTACTAAGGG + Intergenic
940800972 2:158131999-158132021 CACTTTGGCAGAAGGATAAAAGG - Intronic
941051308 2:160737077-160737099 CACAGTGGAAAAGGGATGAAGGG + Intergenic
941884929 2:170518292-170518314 TACTGTGGAAGATGCATAAATGG - Intronic
943174990 2:184460802-184460824 AACTGTGGAAAAGGGAAAAGGGG - Intergenic
943455406 2:188101374-188101396 CACTGGGCAAGAGAGAGAAAGGG - Intergenic
944179770 2:196877988-196878010 GACTCTGGAAAAGGGAAAAAGGG + Intronic
945441970 2:209890338-209890360 CATTGCTGAAGAGGGACTAAAGG - Intronic
945509326 2:210681412-210681434 CTCTATTGAAGAGGGAGAAAAGG + Intergenic
946458327 2:219847852-219847874 AAAGGTGGAAGAGGGAAAAAAGG - Intergenic
947843745 2:233227020-233227042 CAGGGAGGAAGAGGGGCAAATGG + Intronic
948526329 2:238573195-238573217 CCCTGTGGAGGAGTGACAGAGGG + Intergenic
1170104419 20:12737981-12738003 CTGTGTGGAACAGGGACCAATGG - Intergenic
1171199546 20:23230282-23230304 CACTGAGTGAGAGGGAAAAAGGG + Intergenic
1171421705 20:25021935-25021957 CACAGAGGCAGAGGGACAACAGG + Intronic
1172131604 20:32659710-32659732 CACTGTGGGACATGGACAAGTGG - Intergenic
1175788839 20:61728944-61728966 CCCTGGGAGAGAGGGACAAAGGG + Intronic
1176421532 21:6520066-6520088 CCCTCTGGCAGAAGGACAAATGG - Intergenic
1176512909 21:7762117-7762139 CACTGTAGAAGATGGGCAGAGGG + Intronic
1178370064 21:32020190-32020212 CATTTTGGAAGATGGAAAAAAGG - Intronic
1178647022 21:34392641-34392663 CACTGTAGAAGATGGGCAGAGGG + Intronic
1178723270 21:35028916-35028938 CACAGAGGAAGTGGGAAAAAGGG + Intronic
1179320997 21:40291177-40291199 TGCAGTGGAGGAGGGACAAATGG - Intronic
1179578426 21:42321953-42321975 CACTGTGGAACTAGGACAGAGGG + Intergenic
1179697022 21:43128382-43128404 CCCTCTGGCAGAAGGACAAATGG - Intergenic
1179815730 21:43904788-43904810 CACAGTGGGAGAAGGACACAGGG - Intronic
1179921886 21:44512009-44512031 CACAGAGGAAGAGGGCCCAAAGG + Intronic
1180703060 22:17792110-17792132 CACTGTGGCAGGAGGACAGAAGG + Intronic
1181112384 22:20609692-20609714 CACTGGAGAAGAGGGACATGAGG - Intergenic
1183145883 22:35991248-35991270 CACTGTGCAACAGGAAAAAATGG + Intronic
1184152341 22:42646360-42646382 CAGAGGGGAAGAGGGACACAGGG + Intronic
1185080196 22:48705428-48705450 CCCTCTGGAAGACAGACAAAGGG - Intronic
949689188 3:6614917-6614939 CTCTTTGGAGGAGGTACAAAAGG + Intergenic
950159619 3:10750300-10750322 CACTGAAGAAGAGAGACACAAGG - Intergenic
950195820 3:11008429-11008451 CAATGTGGAAGAAGGCCAGAGGG - Intronic
950628577 3:14266610-14266632 CACTCTGGAAGATGTACAGAAGG - Intergenic
951133658 3:19077915-19077937 CACTGGGGAAAAGGGAACAATGG - Intergenic
951251565 3:20400088-20400110 CACTGTAGAAGGGGGAAAAGTGG - Intergenic
951599018 3:24351965-24351987 CTTTTTGGAAGAGGAACAAAGGG + Intronic
954604158 3:51895637-51895659 CACTGTGATATAGGGTCAAAGGG + Intronic
954652414 3:52173287-52173309 CAGTGGGGCACAGGGACAAAGGG - Intergenic
954902558 3:54032187-54032209 CACTGAGGAAGAGGCAGGAAGGG + Intergenic
955080227 3:55651262-55651284 CACTGTGGAAGACCTACAGAGGG - Intronic
956031456 3:65042381-65042403 TACTGGGGAAGGGAGACAAAGGG - Intergenic
956951422 3:74287909-74287931 GACTTTTGAAGAGGGTCAAAGGG - Intronic
958530082 3:95317039-95317061 CAGTGTGGAAGAGAGAGAGAGGG + Intergenic
959798771 3:110464739-110464761 TGCTGTGGCATAGGGACAAATGG + Intergenic
962436373 3:135370822-135370844 CAATGTGGAATAGAGAAAAAGGG - Intergenic
963860528 3:150305247-150305269 CACCGAGGAAGAGGTACAGATGG - Intergenic
964434796 3:156640201-156640223 AACTGTGCATGAGGGAGAAAGGG - Intergenic
964832812 3:160904515-160904537 AAGTGTGGAAGAGGAACAGATGG + Intronic
965275018 3:166671179-166671201 GACAGAGGAAGAGGGAGAAAAGG - Intergenic
966321689 3:178707981-178708003 CTCTGTCCAAGAGGCACAAAGGG - Intronic
966936964 3:184717077-184717099 GACAGTGGAAGAGGGAGAAGGGG - Intergenic
966975392 3:185078585-185078607 CACTGAGGAGGAGGGAAGAAGGG - Exonic
967257228 3:187605909-187605931 CCTTGTGGAATAGTGACAAAAGG + Intergenic
967328133 3:188262934-188262956 AACAGTGGCAGAGGGAGAAAAGG + Intronic
967397764 3:189025471-189025493 CACTCAGGGAGAGGAACAAAGGG - Intronic
967840287 3:193999718-193999740 CACTCTGGAAAAGGGATATAAGG - Intergenic
969110368 4:4840569-4840591 CACTGTGGACCAGCGACACAGGG - Intergenic
969245138 4:5927048-5927070 CACTGTGGAAGGGGAAGATAGGG + Intronic
969510997 4:7617955-7617977 CATGGAGGAAGAGGGAAAAACGG - Intronic
970190753 4:13514379-13514401 CATTGTGGAAGAGGGAGAGGTGG - Intergenic
972171339 4:36349251-36349273 CATTATGGAAGAGAGAGAAATGG - Intergenic
972924021 4:43981566-43981588 CAGTGTGGGAGAGGGAGAGAAGG - Intergenic
973553482 4:52058505-52058527 CAATGTGGCAGAGGCACAGAAGG - Intronic
973594984 4:52478830-52478852 CACTGTGGAAGACAGAAAGATGG - Intergenic
973929223 4:55773071-55773093 TACTTTGGAAGAGGAAAAAAAGG - Intergenic
975110035 4:70612931-70612953 CTGTGTGGACGAGTGACAAATGG - Intergenic
976392433 4:84518911-84518933 CAATGTGGAAGATGAACACAGGG - Intergenic
976830183 4:89306866-89306888 GACAGTGAAAGAGGGAAAAAAGG - Intronic
977196195 4:94063367-94063389 CTCTGGGCAACAGGGACAAATGG - Intergenic
978234518 4:106442650-106442672 GATGGTGGAAGAGGGACAAGAGG + Intergenic
979660795 4:123252778-123252800 ACCTGAGGAAGAGGGAAAAATGG - Intronic
979969916 4:127121914-127121936 AACTGTGGAAGAGGTACTACTGG + Intergenic
980453023 4:132999650-132999672 GACTATAGAAGGGGGACAAAAGG + Intergenic
980839000 4:138234013-138234035 CACTGTGGAAGACAGGCCAAGGG - Intronic
981026484 4:140082170-140082192 GACTGTGAAAGAGGCACAAGGGG - Intronic
981827300 4:148958103-148958125 AAATGTGTAAGAGGGAAAAAAGG - Intergenic
983590633 4:169407173-169407195 CACCGTGAAAGCGGAACAAATGG - Intronic
983897002 4:173091717-173091739 CACTGTAGAAGACTGACAAGGGG - Intergenic
984029836 4:174589724-174589746 CACTGTGGAAAATGGAAACATGG + Intergenic
985716839 5:1467641-1467663 CAAGGAGGTAGAGGGACAAAGGG - Intronic
988953215 5:36286459-36286481 GACTGTGTTGGAGGGACAAAAGG - Intronic
989144805 5:38238205-38238227 CTCTGAGGAAGAAGGAAAAAGGG + Intergenic
990000693 5:50888256-50888278 CACTGTGGAAGATGGTTCAATGG - Intergenic
990393753 5:55355264-55355286 CACTGTAGAAGAGGGAGCACTGG + Intronic
990773651 5:59280527-59280549 AAATGTGAAAGAGGGACAAGAGG - Intronic
993530396 5:89017509-89017531 GACTGTGGAGAAGGCACAAATGG + Intergenic
994875602 5:105417006-105417028 TATTGTGGAAGAGTGTCAAAAGG - Intergenic
994977724 5:106831519-106831541 CACTGGGGAAGCAAGACAAAAGG + Intergenic
996532522 5:124541463-124541485 CACTGGGAAAGAGAGACAAAGGG + Intergenic
998739733 5:145187021-145187043 CACTGTGCTGGAGAGACAAAGGG - Intergenic
999247169 5:150161330-150161352 CACTGTGGAGGATGGACGAAAGG + Intergenic
999277483 5:150341020-150341042 CACTGTGGATGATGGTTAAATGG - Intergenic
1000388745 5:160701126-160701148 CACTGTGGAAAAGAGACTAGAGG - Intronic
1004288964 6:14349261-14349283 TGCTGTGGAAAAAGGACAAATGG - Intergenic
1004958048 6:20752117-20752139 CAATGGGGAAAAGGGAAAAAAGG - Intronic
1005451219 6:25974572-25974594 CACTGTGGAAGACAGACTCAAGG - Intronic
1005721955 6:28611359-28611381 GACGGTGGAAGAGGGAAAAGAGG - Intronic
1006341728 6:33451017-33451039 CACTGTGAATAAGTGACAAACGG + Intronic
1007058234 6:38910332-38910354 CACTGTGTAAGATTGACAAATGG + Intronic
1007068677 6:39018727-39018749 CAGTGTGGAAGAGGGAAACCAGG + Intronic
1007288389 6:40765097-40765119 CCCTGTGGCAGAAGGAAAAAAGG + Intergenic
1007293419 6:40803626-40803648 CACTGAAGAAAAGGGACACAGGG + Intergenic
1008168622 6:48173203-48173225 CAATGTGCAAGAGAGACAAATGG + Intergenic
1008317181 6:50058923-50058945 AAATGTGGAAAAGCGACAAAAGG + Intergenic
1013292677 6:108732555-108732577 CACTGTGGATGGGTAACAAAAGG + Intergenic
1013532205 6:111030293-111030315 CAGTGTGTGAGAGGGACAGAGGG - Intergenic
1014164295 6:118205974-118205996 GACTGGGGAAGGGGGACATAGGG + Intronic
1014607906 6:123500712-123500734 CCCTGTGGAATAGTAACAAAGGG + Intronic
1014909453 6:127072895-127072917 CACTGTAGAAAAGGGACAGCAGG + Intergenic
1017701450 6:157076850-157076872 CACTGAGGAAGAGAGAGAGATGG - Intronic
1018631493 6:165826495-165826517 CACTGGGACAGAGGGACACAGGG - Intronic
1019030679 6:169008178-169008200 CACGGTGGAAAAGAGACAAATGG + Intergenic
1020367599 7:7396884-7396906 GACAGGGGAAGAGGTACAAATGG - Intronic
1021041577 7:15869355-15869377 CACTGTGCCAAAGGGACAGAGGG + Intergenic
1021054481 7:16029987-16030009 CACTATGTAAGGAGGACAAATGG - Intergenic
1021655686 7:22871294-22871316 GACTGTGGAGGGAGGACAAAGGG + Intergenic
1021732318 7:23607961-23607983 CACTTGGAGAGAGGGACAAAGGG + Intronic
1023002622 7:35826870-35826892 AACTTTGGAATAGGAACAAATGG + Intronic
1023426561 7:40043086-40043108 CAATATGGAAGAGAGATAAAAGG - Intronic
1023924578 7:44657103-44657125 CACTGGGGAAGCTGGCCAAAGGG - Intronic
1024828119 7:53416369-53416391 AACTGTGGCAGATGGAGAAATGG - Intergenic
1026223078 7:68417317-68417339 CACTTTGGAAGTTGGAAAAAGGG - Intergenic
1027629137 7:80580504-80580526 CTCCTTGGAAGAGGGATAAAAGG + Intronic
1028860856 7:95648627-95648649 CACATTGGAAGAGGAAGAAAAGG - Intergenic
1029943853 7:104511168-104511190 CACTGAGGAAGATATACAAATGG + Intronic
1031420874 7:121550306-121550328 CACAGGATAAGAGGGACAAAGGG - Intergenic
1031630708 7:124039570-124039592 CCATGAGGAAGAGGTACAAAAGG - Intergenic
1033225168 7:139555764-139555786 CACAATGGAAGATAGACAAATGG - Intergenic
1033435454 7:141329504-141329526 TCCTGTGGAAGAGGAATAAAAGG - Intronic
1034281304 7:149856285-149856307 TACTGTGGAAGATGGAGATACGG + Intronic
1035449973 7:158970833-158970855 CTCTGTGGAACAGTGACAAGTGG + Intergenic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038974952 8:32684999-32685021 CATTGGGGAAAATGGACAAAGGG - Intronic
1039268537 8:35854875-35854897 CAGTGTGGAGGAGGGACCAGTGG - Intergenic
1039777613 8:40752279-40752301 CCCAGTGGCAGAGGGACACAGGG - Intronic
1040372407 8:46789637-46789659 CACTGTGGAAGTGGGTCCTATGG + Intergenic
1041731652 8:61068937-61068959 CACTGTGGAAGAGGGACAAATGG - Intronic
1042002848 8:64145720-64145742 CACTTTGAAGGAGGGGCAAATGG + Intergenic
1042367155 8:67950724-67950746 CCCTGTGGCAGAAGAACAAAGGG - Intergenic
1043087292 8:75850047-75850069 CTCTGTGGCACAGGGACAAATGG - Intergenic
1043295813 8:78662227-78662249 CACTGAGGATGAGGGAAACATGG - Intergenic
1043860842 8:85314970-85314992 GACTGTGGGAGAGGTACACATGG + Intergenic
1044695791 8:94921183-94921205 CAATGTGCAAGAAGGACAGAAGG - Intronic
1045325846 8:101117144-101117166 TAGTGTGGCAGATGGACAAACGG + Intergenic
1045722647 8:105131739-105131761 CAGAATGGAGGAGGGACAAAGGG - Intronic
1046256478 8:111703890-111703912 AACAGTGGAAAAGGGAAAAAAGG - Intergenic
1046784849 8:118254820-118254842 CAATGTGGGAGAGGAAGAAAAGG - Intronic
1046809031 8:118512735-118512757 CAATGTCAAAGAGGCACAAAAGG - Intronic
1047381125 8:124364212-124364234 CACAATGGAAGAGTGACAATTGG + Intronic
1048065151 8:130960166-130960188 GACTGTGAAAGAGGGAAAGAGGG + Intronic
1050028851 9:1364297-1364319 GACAGTGGAAGAGGGAAATAAGG + Intergenic
1050466449 9:5929538-5929560 GACTGGGGAAAAGGGAGAAAAGG + Intronic
1051031839 9:12690155-12690177 CACTGTGGAAAAAGCACAGAAGG - Intronic
1051343943 9:16135829-16135851 CAGTATGGAGGAGGGAAAAAAGG + Intergenic
1053508026 9:38661503-38661525 GATGGTGGAAGAGGGAGAAAAGG + Intergenic
1055505349 9:76942487-76942509 TACTGTGGAGGAGAGAGAAAAGG - Intergenic
1056139081 9:83657022-83657044 CAGTTTGGAAGAGAGAGAAACGG - Intergenic
1056847548 9:90053930-90053952 CCCTGAACAAGAGGGACAAATGG + Intergenic
1057590115 9:96365426-96365448 AACTGTGGCAGAGGGAGAAAGGG + Intronic
1058069906 9:100591387-100591409 CAGTGTGGCTGAGGAACAAAGGG + Intergenic
1058817397 9:108697447-108697469 CACTGGGGAAATGGGATAAAGGG - Intergenic
1058872918 9:109218017-109218039 CTCTGTGGAGGATGGACTAAAGG - Intronic
1059530426 9:115030404-115030426 AACTGTGGAATAAGGAGAAATGG + Exonic
1059612060 9:115909124-115909146 TGCTGTGGAAGGGGGATAAATGG + Intergenic
1059740551 9:117145563-117145585 GACTGTGGAAAAGGGACACTGGG - Intronic
1060303699 9:122392005-122392027 CACTGGGGAAAAGGGTCAAGAGG - Intronic
1061309887 9:129755243-129755265 CCCTGGGGAAGTGGGGCAAAGGG + Intergenic
1061509376 9:131051064-131051086 CTCTGGGGCAGAGGGACACAGGG + Intronic
1062176794 9:135167819-135167841 CACTGTGGCAGACACACAAAAGG - Intergenic
1186127707 X:6431994-6432016 GACTGAGGAGAAGGGACAAATGG - Intergenic
1186559008 X:10590418-10590440 CACTGTGGAAGAGTGGCACAGGG - Intronic
1189203076 X:39214623-39214645 CACTGTTGGAGAGGGAGGAATGG + Intergenic
1189415110 X:40806059-40806081 CACTGTGGCAGAGAGAGAAGAGG - Intergenic
1189558283 X:42166925-42166947 CACTGAGGAAGTGGGACCACTGG - Intergenic
1189698346 X:43689344-43689366 AACTGTTAAAGTGGGACAAATGG - Intronic
1190634190 X:52418352-52418374 TTCTCTGCAAGAGGGACAAAAGG - Intergenic
1192260375 X:69502904-69502926 GTTTCTGGAAGAGGGACAAATGG - Intergenic
1192272939 X:69600690-69600712 CACTTTGGAAGTGGGAGAAGAGG + Intergenic
1194761150 X:97797567-97797589 CACTTTGAGAGAGGGGCAAAGGG - Intergenic
1195216455 X:102708992-102709014 CAGTGAGTAAGAGGGACAAAAGG + Intergenic
1195638753 X:107150453-107150475 CACTATAGAAGACGGAAAAAAGG + Intronic
1196097200 X:111813195-111813217 CACTGTGGAAAGTGGAGAAAAGG - Intronic
1198444736 X:136701118-136701140 AACTGTGGAACAAGTACAAAAGG + Intronic
1199342501 X:146697994-146698016 CAAAGTGGCACAGGGACAAATGG + Intergenic
1202306214 Y:23473688-23473710 CAGTGTGGAAGGGGGAAAGATGG + Intergenic
1202564595 Y:26196901-26196923 CAGTGTGGAAGGGGGAAAGATGG - Intergenic