ID: 1041731708

View in Genome Browser
Species Human (GRCh38)
Location 8:61069420-61069442
Sequence AAGGGAAAACAGAGGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3802
Summary {0: 1, 1: 2, 2: 21, 3: 425, 4: 3353}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041731708 Original CRISPR AAGGGAAAACAGAGGAAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr