ID: 1041735804

View in Genome Browser
Species Human (GRCh38)
Location 8:61109297-61109319
Sequence CCCTGGCACCTGTGAACTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041735799_1041735804 10 Left 1041735799 8:61109264-61109286 CCAAAGTCTAAATGAAGTAATTT 0: 1
1: 0
2: 0
3: 29
4: 379
Right 1041735804 8:61109297-61109319 CCCTGGCACCTGTGAACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041735804 Original CRISPR CCCTGGCACCTGTGAACTGT TGG Intronic
No off target data available for this crispr