ID: 1041737001

View in Genome Browser
Species Human (GRCh38)
Location 8:61121381-61121403
Sequence CGGTGAATAAGGAGCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041737001_1041737005 3 Left 1041737001 8:61121381-61121403 CCATCTTGGCTCCTTATTCACCG 0: 1
1: 0
2: 1
3: 10
4: 131
Right 1041737005 8:61121407-61121429 ACTCTTATTTTTTCAACTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041737001 Original CRISPR CGGTGAATAAGGAGCCAAGA TGG (reversed) Intronic
907586042 1:55618837-55618859 CTGTGAAGAAAGAGCCAAGCAGG - Intergenic
911088019 1:93995762-93995784 TGGGGAATAAGGAGCAGAGAAGG - Intronic
913501743 1:119478131-119478153 TGGTGAATAAGGAGCTGGGAAGG - Intergenic
913513499 1:119583257-119583279 TGGTGAATAAGGAGCTGGGAAGG - Intergenic
913517125 1:119614200-119614222 TGGTGAATAAGGAGCTGGGAAGG - Intergenic
914504952 1:148280980-148281002 GGGTGAAGGCGGAGCCAAGAAGG - Intergenic
914507612 1:148303168-148303190 GGGTGAAGGCGGAGCCAAGAAGG + Intergenic
915237161 1:154492384-154492406 CGGAGAATGAGGAACCAAGATGG - Intronic
915456157 1:156042132-156042154 AGGTGAGTGAGGAGCCTAGATGG - Exonic
921568026 1:216744139-216744161 GGGTGGATAAGGAACCATGAGGG + Intronic
922076503 1:222250230-222250252 TGGATAAGAAGGAGCCAAGATGG - Intergenic
923946839 1:238897933-238897955 GGGTGAATAAGGAGGGAAGCAGG + Intergenic
924132647 1:240927955-240927977 GGGTTAATCAGGAGCCAACATGG - Intronic
1063357522 10:5414754-5414776 GGTTGAACAAGGATCCAAGAAGG + Intronic
1063495967 10:6508645-6508667 TTGTGAATAAGGAGTAAAGATGG + Intronic
1063545240 10:6974720-6974742 CAGTGAATAAGTTGCCATGAAGG - Intergenic
1068798196 10:61107807-61107829 GGGTGAGAAAGGAGACAAGAGGG + Intergenic
1072855002 10:98937091-98937113 CTGTGACAATGGAGCCAAGATGG + Intronic
1087087915 11:94238510-94238532 TGGCGAAGGAGGAGCCAAGATGG - Intergenic
1087285611 11:96261984-96262006 TGGAGAATAATGAGCCAGGAGGG - Intronic
1089905104 11:122030431-122030453 AGGTGAAAACGGAGCCAAGTTGG + Intergenic
1090241999 11:125190496-125190518 CCATAAATAAGGAACCAAGAGGG - Intronic
1094437905 12:30441710-30441732 CGGTGAGTAAGGAGAAAACAGGG + Intergenic
1098794701 12:74874865-74874887 TGGTGGAGGAGGAGCCAAGATGG + Intergenic
1100001284 12:89838969-89838991 CTGAGAATAAGGAGTCAAGGAGG + Intergenic
1107435506 13:40377421-40377443 CGGTGGATGACGAGGCAAGAGGG + Intergenic
1109438329 13:62335626-62335648 AGGAGAAAAAGGAGCCAGGAGGG + Intergenic
1114003869 14:18289846-18289868 CGGAGGAGGAGGAGCCAAGATGG - Intergenic
1119641233 14:76316472-76316494 AGGTGAATAATGAGGCAAAAAGG - Intronic
1122276838 14:100594984-100595006 TGGTGAGGAAGGAGCCCAGATGG - Intergenic
1127016849 15:54698815-54698837 CGGGAGAGAAGGAGCCAAGATGG + Intergenic
1129186108 15:73907891-73907913 CGGTCAACCAGGAGCCTAGATGG + Intergenic
1129250391 15:74305556-74305578 CAGTGCTTCAGGAGCCAAGAAGG + Intronic
1133463566 16:6008242-6008264 GAGTGAATAAAGAGACAAGAGGG + Intergenic
1138612981 16:58142122-58142144 CTGGGAATAAGCAGACAAGATGG - Intergenic
1140884245 16:79228946-79228968 TGGGGAATGAGGGGCCAAGATGG + Intergenic
1141258229 16:82423959-82423981 CAATGAATAAGGAGCAAAGTTGG - Intergenic
1142308332 16:89298167-89298189 TGGTGAACAAGAAGCCAGGAAGG + Intronic
1143028386 17:3953953-3953975 GGATGAGTACGGAGCCAAGAGGG + Intronic
1143116099 17:4582615-4582637 CTGAGAAAAAGGAGCCAAGGGGG + Intergenic
1143682502 17:8487864-8487886 CGGTGTAGATGAAGCCAAGATGG + Intronic
1143912799 17:10265852-10265874 CACAGAATAAGGAGTCAAGAGGG + Intergenic
1148848741 17:50543988-50544010 GGGTGGATCAGGGGCCAAGAAGG - Intronic
1150901420 17:69282289-69282311 CAGTGGAGAAGGAGCCAAGAGGG - Intronic
1151609199 17:75160685-75160707 CAGTTAAAAAGGACCCAAGAGGG - Intronic
1153011518 18:543929-543951 AGGTGAAGAAAGAGCCATGAGGG + Intergenic
1160274883 18:77421984-77422006 GGATGAGGAAGGAGCCAAGATGG - Intergenic
1167702271 19:51056502-51056524 CTGGGAATAAGGAGCAGAGAAGG + Intronic
925578911 2:5389876-5389898 CGGTGCCTTAGAAGCCAAGAAGG - Intergenic
926371191 2:12180471-12180493 GCGTGAATAAGAAGGCAAGATGG + Intergenic
929080866 2:38120964-38120986 GGGTGAATAAGTAACCAAAAAGG + Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
931105161 2:59047275-59047297 ATGTAAATAAGAAGCCAAGAAGG - Intergenic
932863960 2:75322171-75322193 AGGTGAAAAAGGGGCTAAGATGG - Intergenic
938704421 2:133910477-133910499 AGGGGAAGAAGCAGCCAAGATGG + Intergenic
940061755 2:149578644-149578666 GGAAGAACAAGGAGCCAAGAAGG + Intronic
941985258 2:171504438-171504460 TGGTGGATTAGCAGCCAAGATGG - Intergenic
944018746 2:195075238-195075260 CGGGGAAAAAGGAACCAAGTTGG + Intergenic
948016399 2:234694354-234694376 TGGTGAACCAGGAGGCAAGAGGG + Intergenic
1170290625 20:14764581-14764603 GGGTAAATAAGGATCCATGAAGG - Intronic
1175830671 20:61963868-61963890 CTGTGAAGAAATAGCCAAGATGG + Intronic
1178593449 21:33931593-33931615 ATGAGAATAAGGAGCCAAGATGG - Intergenic
1178728175 21:35073863-35073885 ATGTTAATGAGGAGCCAAGAAGG - Intronic
1180913738 22:19471015-19471037 AGGAGAAGAAGGAGCCAAGTGGG + Intronic
949737849 3:7194971-7194993 CAGCGAATAAGGAACCAAGAAGG - Intronic
949797254 3:7864481-7864503 CGGTGAAAGAGGGGGCAAGAGGG - Intergenic
951124174 3:18963815-18963837 TGGTGAGAGAGGAGCCAAGATGG - Intergenic
951175027 3:19589112-19589134 GGGTGTATGAGGAGGCAAGATGG - Intergenic
952003335 3:28810853-28810875 AGGTGGATAGGGAGCCAGGAGGG + Intergenic
954364385 3:50138515-50138537 GGGGGAATGAGGAGCCAGGAGGG - Intergenic
954418144 3:50404173-50404195 CAGAGAATAGGGATCCAAGATGG + Intronic
960054214 3:113265083-113265105 GGGTGCAGCAGGAGCCAAGAGGG + Intronic
967378294 3:188829759-188829781 TGGTGAGTAAGTAGCCAAGCTGG - Intronic
968967890 4:3778542-3778564 AGGTGAAGACGGAGCGAAGATGG - Intergenic
969660842 4:8526571-8526593 CGCTGAATAAGGAGGCTGGAGGG - Intergenic
973145011 4:46814286-46814308 CAGTGAATAAGGAAACAAAATGG - Intronic
973740272 4:53912694-53912716 GAGAGAATAAAGAGCCAAGAAGG - Intronic
975118784 4:70705908-70705930 CGGTGCATGAGAAGACAAGAAGG + Intronic
975280389 4:72555468-72555490 CTGTGGATAAGTTGCCAAGAAGG - Intronic
975518896 4:75276589-75276611 TGGTGGAGGAGGAGCCAAGATGG - Intergenic
977482001 4:97590582-97590604 TGGTGAATTAGTATCCAAGATGG + Intronic
977807641 4:101321673-101321695 CAGTGAATAAGCCTCCAAGATGG + Intronic
984026697 4:174551370-174551392 CGGTGGATTAGCATCCAAGATGG - Intergenic
987455961 5:18146821-18146843 AGGGGAATAAGGAGAAAAGATGG + Intergenic
993046534 5:82872767-82872789 AGGGGGATATGGAGCCAAGATGG - Intergenic
997440361 5:133904874-133904896 AGGTGGACCAGGAGCCAAGAAGG + Intergenic
998326598 5:141286445-141286467 CGATGAGAAAGGAGGCAAGAGGG + Intergenic
998555880 5:143123302-143123324 CAGTGAAAAAGGAGTCAAGATGG - Intronic
999537001 5:152528676-152528698 TGGTGGATAAGGAGCCAGAAGGG + Intergenic
1004480706 6:16016543-16016565 GGTTGAAGGAGGAGCCAAGATGG - Intergenic
1005904318 6:30247879-30247901 CAGCGAGGAAGGAGCCAAGATGG + Intergenic
1006272731 6:32976611-32976633 TGGAGAACCAGGAGCCAAGATGG - Exonic
1006977874 6:38120624-38120646 CAGTGATTAAGAAGCCAAGAAGG - Intronic
1007858655 6:44884621-44884643 ATGTGGATCAGGAGCCAAGATGG + Intronic
1010382739 6:75243450-75243472 TGGTGACTAAGAACCCAAGACGG + Intronic
1010998259 6:82558396-82558418 CGGAGATCGAGGAGCCAAGATGG + Intergenic
1011125761 6:84005957-84005979 AGGTGATTAAGAAGTCAAGAGGG - Intergenic
1011918671 6:92543444-92543466 CGGTCACTGAGGAGCCAAGAGGG + Intergenic
1012017624 6:93871765-93871787 ATGTGGAGAAGGAGCCAAGATGG - Intergenic
1013792410 6:113852675-113852697 CCGTAGAAAAGGAGCCAAGATGG - Intergenic
1015222807 6:130824344-130824366 AGGTGAGAAAGGAGCCTAGAGGG - Intergenic
1016282170 6:142430835-142430857 TGGTGAATAAGCAGCCAAGAAGG - Intronic
1018959067 6:168433758-168433780 AGGTGATTAAAAAGCCAAGAAGG - Intergenic
1021434779 7:20601679-20601701 TGGTGGATTAGCAGCCAAGATGG + Intergenic
1024286226 7:47760034-47760056 TGTTGAATAAGATGCCAAGAAGG - Intronic
1024440270 7:49408434-49408456 AGGTGAATGAGGAGGCCAGAAGG - Intergenic
1027989285 7:85335725-85335747 CGGACACTGAGGAGCCAAGATGG - Intergenic
1030185982 7:106762331-106762353 CAGTGAACTAGGGGCCAAGAAGG + Intergenic
1030893753 7:115031097-115031119 CGGGGAGGGAGGAGCCAAGATGG - Intergenic
1031054685 7:116980404-116980426 AGGAGACTAAGGAGCCAATAGGG - Intronic
1031934443 7:127721717-127721739 CTGTGAATAAGGAGAGGAGAAGG + Intronic
1032467604 7:132156246-132156268 CAGGCATTAAGGAGCCAAGATGG - Intronic
1032850821 7:135793588-135793610 TGGAGCATAAGAAGCCAAGAGGG - Intergenic
1033292361 7:140097689-140097711 CGATGAACAAGGTGACAAGATGG + Intronic
1036143191 8:6227112-6227134 TGGTGAATAAGGAACAAAGAGGG - Intergenic
1037717280 8:21411127-21411149 CTGTGAGTGAGGAGCCACGATGG - Intergenic
1039263771 8:35802453-35802475 CGGGGAAGAAGGAGGCAAGCAGG + Intergenic
1041737001 8:61121381-61121403 CGGTGAATAAGGAGCCAAGATGG - Intronic
1041881185 8:62751231-62751253 AGGTGGATAAGGAGCCCAGGTGG - Intronic
1042977980 8:74492162-74492184 CAGTGATCAAGGAGTCAAGAAGG + Intergenic
1044131668 8:88531266-88531288 CAATGAATAAGGAGCAAAGACGG - Intergenic
1045646298 8:104302889-104302911 TGGTGAAATAGGAGTCAAGATGG + Intergenic
1045651936 8:104349355-104349377 CGCTGAATAAGGAGGAAAGGAGG + Exonic
1046103109 8:109636993-109637015 AGATGAATAAGGATCAAAGATGG - Intronic
1046149220 8:110202148-110202170 CGGTGCATAAGGGGACCAGACGG + Intergenic
1049872478 8:144991245-144991267 CATTGAGGAAGGAGCCAAGATGG - Intergenic
1050689049 9:8204580-8204602 CAGGGAAGGAGGAGCCAAGATGG - Intergenic
1051998629 9:23249284-23249306 CGGGGAGTATGGAACCAAGATGG + Intergenic
1052083088 9:24230658-24230680 CGCTGAATGTGGAGCCAAGATGG - Intergenic
1055158385 9:73094001-73094023 CGGTGATTAAGGACACGAGAGGG - Intergenic
1055689022 9:78809758-78809780 TGGTGAATTAGCATCCAAGATGG - Intergenic
1056387685 9:86112564-86112586 CAGTGAATCAGGGGCCAAGGGGG + Intergenic
1057877565 9:98769386-98769408 AGGTGAATATGGAGGCATGAAGG + Intronic
1060514803 9:124258732-124258754 CGGTGAACCAGGGGCCAGGAGGG + Intronic
1060602443 9:124887145-124887167 CGCTGAACAAGGAGGCAGGAAGG + Intronic
1061085710 9:128397003-128397025 AGGGAAATGAGGAGCCAAGAAGG + Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1188066322 X:25664613-25664635 GGATGAATAAGGAGACATGAGGG - Intergenic
1189606464 X:42683457-42683479 GGGTGAATCATAAGCCAAGAAGG + Intergenic
1191932142 X:66385761-66385783 CAGTGAGTAAGGAGTTAAGAGGG + Intergenic
1192844652 X:74893598-74893620 AGGTGATTAAGCACCCAAGATGG + Intronic
1194158683 X:90423972-90423994 CGGGGAAAACGGAGCCAAGTTGG + Intergenic
1199584110 X:149395150-149395172 AGAAGAATAAGGAGCCAAGGGGG - Intergenic