ID: 1041738269

View in Genome Browser
Species Human (GRCh38)
Location 8:61133588-61133610
Sequence CACCTTGAGGGGCTTGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041738262_1041738269 27 Left 1041738262 8:61133538-61133560 CCTTTTGTGTCACATTGAGGAGC 0: 1
1: 0
2: 0
3: 7
4: 173
Right 1041738269 8:61133588-61133610 CACCTTGAGGGGCTTGAGGTTGG No data
1041738264_1041738269 -7 Left 1041738264 8:61133572-61133594 CCTGTGAATGAAACGGCACCTTG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1041738269 8:61133588-61133610 CACCTTGAGGGGCTTGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041738269 Original CRISPR CACCTTGAGGGGCTTGAGGT TGG Intronic
No off target data available for this crispr