ID: 1041738902

View in Genome Browser
Species Human (GRCh38)
Location 8:61138650-61138672
Sequence CTGGACTCCTGGGGACCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 906
Summary {0: 1, 1: 0, 2: 2, 3: 64, 4: 839}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041738902_1041738912 26 Left 1041738902 8:61138650-61138672 CCAGTGGGTCCCCAGGAGTCCAG 0: 1
1: 0
2: 2
3: 64
4: 839
Right 1041738912 8:61138699-61138721 TCATGGACCGAGCCAGAGAAGGG No data
1041738902_1041738909 1 Left 1041738902 8:61138650-61138672 CCAGTGGGTCCCCAGGAGTCCAG 0: 1
1: 0
2: 2
3: 64
4: 839
Right 1041738909 8:61138674-61138696 GCTGGCAGTGGTCTGAAGAGTGG No data
1041738902_1041738913 27 Left 1041738902 8:61138650-61138672 CCAGTGGGTCCCCAGGAGTCCAG 0: 1
1: 0
2: 2
3: 64
4: 839
Right 1041738913 8:61138700-61138722 CATGGACCGAGCCAGAGAAGGGG No data
1041738902_1041738914 28 Left 1041738902 8:61138650-61138672 CCAGTGGGTCCCCAGGAGTCCAG 0: 1
1: 0
2: 2
3: 64
4: 839
Right 1041738914 8:61138701-61138723 ATGGACCGAGCCAGAGAAGGGGG No data
1041738902_1041738911 25 Left 1041738902 8:61138650-61138672 CCAGTGGGTCCCCAGGAGTCCAG 0: 1
1: 0
2: 2
3: 64
4: 839
Right 1041738911 8:61138698-61138720 ATCATGGACCGAGCCAGAGAAGG No data
1041738902_1041738910 9 Left 1041738902 8:61138650-61138672 CCAGTGGGTCCCCAGGAGTCCAG 0: 1
1: 0
2: 2
3: 64
4: 839
Right 1041738910 8:61138682-61138704 TGGTCTGAAGAGTGGTATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041738902 Original CRISPR CTGGACTCCTGGGGACCCAC TGG (reversed) Intronic
900041032 1:464553-464575 CTGGACTTCTGTGAATCCACAGG + Intergenic
900140825 1:1138959-1138981 CTGGACCCCAGGGGCCACACTGG + Intergenic
900197092 1:1381949-1381971 TGGGGCTCCTGGGGAACCACTGG + Intergenic
900505667 1:3028847-3028869 CGGGTTTCCTGGGGACCCCCAGG - Intergenic
900730829 1:4258486-4258508 CTTGACTTCTGTGCACCCACAGG - Intergenic
901160560 1:7173867-7173889 GTGGAACCCAGGGGACCCACAGG + Intronic
901781765 1:11598975-11598997 CTGGGCTTCTGGGGACTCCCAGG + Intergenic
902219900 1:14958149-14958171 CTGGACTACTAGGGATCCACTGG - Intronic
902406990 1:16189833-16189855 CTGGACACCAGGAGACCCACTGG - Intergenic
903645330 1:24892217-24892239 CTTGACTTCTGTGCACCCACAGG + Intergenic
903809001 1:26024230-26024252 CTGGCCTGCTGGGGACACAGAGG - Intronic
904052126 1:27646095-27646117 CTAGACTCCCAGGGACCCCCAGG - Intergenic
904321014 1:29697874-29697896 CAGAACTCATGGAGACCCACAGG - Intergenic
904572039 1:31473488-31473510 CTTGACTTCTGTGTACCCACAGG + Intergenic
906108178 1:43307057-43307079 AGGGGCTCCAGGGGACCCACAGG - Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907222097 1:52914578-52914600 CTGGGCTCCTGGGCACACACGGG - Intronic
907555897 1:55344070-55344092 CTTGACTTCTGTGCACCCACAGG - Intergenic
907615277 1:55918203-55918225 CTGGGCTTCTGGGGAGCCTCAGG + Intergenic
908020006 1:59889466-59889488 CTTGACTTCTGTGCACCCACAGG + Intergenic
909192596 1:72573046-72573068 CTTGACTTCTGTGTACCCACAGG - Intergenic
909656778 1:78041868-78041890 CTGGACTCAAGGGGATCCTCTGG + Intronic
910141511 1:84031768-84031790 CTTGACTTCTGTGTACCCACAGG + Intergenic
910512905 1:88025867-88025889 CTTGACTTCTGTGAACCCACAGG + Intergenic
910628899 1:89337130-89337152 GTTGACTTCTGGGCACCCACAGG - Intergenic
910817910 1:91312015-91312037 CTTGACTTCTGTGTACCCACAGG - Intronic
911267682 1:95762335-95762357 CTTGACTTCTGTGCACCCACAGG + Intergenic
912009954 1:104947358-104947380 CTTGACTTCTGTGCACCCACAGG - Intergenic
912687639 1:111779667-111779689 CTGGACTCCCTGAGAACCACAGG + Intronic
914351623 1:146844963-146844985 CTTGACTTCTGTGCACCCACAGG + Intergenic
916688894 1:167172232-167172254 CTTGACTTCTGTGTACCCACAGG - Intergenic
916814440 1:168337790-168337812 CTTGACTTCTGTGCACCCACAGG + Intergenic
916850185 1:168695655-168695677 CTGGAACCCTGGGGAGCTACTGG - Exonic
916948888 1:169758851-169758873 CTTGACTCCTGTGCACCCACAGG + Intronic
916976430 1:170085067-170085089 ATGGGCTCCTTGGGCCCCACTGG - Intronic
917042545 1:170822082-170822104 CTAGCATCCTGAGGACCCACTGG + Intergenic
917894551 1:179475048-179475070 CTTGACTTCTGTGCACCCACAGG - Intronic
919834250 1:201562845-201562867 TTGGACTTCTGGTGACTCACTGG - Intergenic
920304467 1:205009738-205009760 CTGGAGACCTGGAGACTCACGGG - Intronic
920783704 1:209020249-209020271 CTTGACTTCTGGGCACTCACAGG - Intergenic
921452377 1:215324009-215324031 CTTGACTTCTGTGCACCCACAGG + Intergenic
922763854 1:228147773-228147795 CAGGAGGTCTGGGGACCCACAGG - Intronic
923088752 1:230722224-230722246 CTTGTCTCCTGTGCACCCACAGG - Intergenic
923428033 1:233891501-233891523 CTTGACTTCTGCGTACCCACAGG - Intergenic
924639894 1:245823990-245824012 CTGGACTCTTAAGGACCCAAAGG + Intronic
924806585 1:247366427-247366449 CTTGACTTCTGTGCACCCACAGG - Intergenic
1062770124 10:92499-92521 CTGCACTCTTGGGGGCCCCCAGG - Intergenic
1064174002 10:13058354-13058376 CTGGACTGCTGCTGACCCACAGG - Intronic
1064253182 10:13722540-13722562 CTGGCCTCATTGGGACCCTCTGG + Intronic
1064626509 10:17266851-17266873 CTTGACTTCTGTGCACCCACAGG - Intergenic
1064628165 10:17282684-17282706 CTTGACTTCTGTGCACCCACAGG - Intergenic
1065408134 10:25391066-25391088 CTTGACTTCTGTGCACCCACAGG - Intronic
1065782781 10:29186202-29186224 GTGGACACCAGGGGACGCACAGG - Intergenic
1067012199 10:42724759-42724781 CTGGCCTCCTGGGGCACCCCTGG + Intergenic
1067155811 10:43780348-43780370 CTTGATTCCTGGGCACCCCCTGG + Intergenic
1067311396 10:45117134-45117156 CTGGCCTCCTGGGGCACCCCTGG - Intergenic
1067444037 10:46329486-46329508 CAGGACCCATCGGGACCCACAGG - Intronic
1067573258 10:47386897-47386919 CTTGACTTCTGTGCACCCACAGG + Intergenic
1068221543 10:54051996-54052018 CTTGACTTCTGTGCACCCACAGG - Intronic
1068243557 10:54336587-54336609 CTTGACTTCTGCGGACCCATAGG - Intronic
1069095039 10:64249311-64249333 CTTGACTTCTGTGCACCCACAGG + Intergenic
1069659931 10:70116863-70116885 CTGGACCTCTGGGGCCCAACTGG + Intronic
1069794067 10:71041253-71041275 CTGGCCTCCTGGGGACCGAGCGG + Intergenic
1069804142 10:71107337-71107359 CTTGACTTCTGTGCACCCACAGG - Intergenic
1070870080 10:79743848-79743870 CTTGACTTCTGTGCACCCACAGG - Intergenic
1071395402 10:85218628-85218650 CTTGACTTCTGTGCACCCACAGG - Intergenic
1071637002 10:87266068-87266090 CTTGACTTCTGTGCACCCACAGG - Intergenic
1071658242 10:87471886-87471908 CTTGACTTCTGTGCACCCACAGG + Intergenic
1071818290 10:89254307-89254329 CTTGACTTCTGTGCACCCACAGG + Intronic
1072368966 10:94744660-94744682 CTTGACTTCTGTGCACCCACAGG - Intronic
1073124440 10:101140807-101140829 CTGGGTTCCTGGGGCCCCTCAGG - Intergenic
1073153436 10:101327822-101327844 CTTGACTTCTGTGCACCCACAGG - Intergenic
1073848104 10:107582963-107582985 CTGGACTCCTGGGTTCCTAAAGG - Intergenic
1074041419 10:109793341-109793363 CTTGACTTCTGTGTACCCACAGG + Intergenic
1074069145 10:110049153-110049175 CTTGACTCCTGTGCACCCACAGG - Intronic
1074142740 10:110689280-110689302 CTGGAGGCCTGGGGACACAGGGG + Intronic
1074260485 10:111848592-111848614 CTTGACTCCTGTGCACCCTCAGG - Intergenic
1074424935 10:113342426-113342448 CTGGTCTCCTGGGGAAACAGTGG + Intergenic
1074619614 10:115105758-115105780 CTTGACTCCTGTGCACCCGCAGG - Intronic
1074640243 10:115371078-115371100 CTTGACTTCTGTGTACCCACAGG - Intronic
1075281660 10:121144000-121144022 CTTGACTTCTGTGCACCCACAGG + Intergenic
1075354264 10:121756611-121756633 CTTGACTTCTGTGCACCCACAGG + Intronic
1075550347 10:123388258-123388280 CTTGACTCCTGTGAACCCACAGG - Intergenic
1075583169 10:123637648-123637670 CCAGACTCCTGGGGCCCCACTGG - Intergenic
1075877664 10:125821955-125821977 CTGGGCTCCTGGGGACCTTTAGG + Intronic
1075937988 10:126359973-126359995 CTTGACTTCTGTGTACCCACAGG + Intronic
1076456598 10:130604294-130604316 CTGAACTCCTGGGAACCACCAGG + Intergenic
1076864695 10:133160880-133160902 CTGGCCTCCTGGGGCCCGGCAGG - Intronic
1076926814 10:133494903-133494925 CTTGACTTCTGTGTACCCACAGG + Intergenic
1077138039 11:1011328-1011350 CTGGAGTCCTGGGGGCCCTGCGG - Exonic
1077426218 11:2479428-2479450 CTTGACTTCTGTGCACCCACAGG + Intronic
1077498324 11:2897376-2897398 CTGGTATCCTTGGGACCCAGGGG - Intronic
1077574985 11:3376141-3376163 CGGGAGCACTGGGGACCCACAGG - Intronic
1078901855 11:15649946-15649968 CTGGACCCCTGGGGACACAGGGG - Intergenic
1079176948 11:18151036-18151058 CTGGAATCCTGAGGAGCCACAGG - Intronic
1079178956 11:18171576-18171598 CTGGAATCCTGAGGATGCACAGG - Intronic
1079536981 11:21526656-21526678 CTTGACTTCTGGGCACCCACAGG + Intronic
1079546825 11:21643164-21643186 CTTGACTTCTGTGTACCCACAGG - Intergenic
1079834988 11:25323128-25323150 CTTGACTTCTGTGTACCCACAGG - Intergenic
1080088519 11:28315870-28315892 CTTGACTTCTGTGCACCCACAGG - Intronic
1080973324 11:37304146-37304168 CTTGACTTCTGTGGACCCACAGG + Intergenic
1081077683 11:38696558-38696580 CTTGACTTCTGTGGACCCACAGG + Intergenic
1081349120 11:42026998-42027020 CTTGACTTCTGTGCACCCACAGG + Intergenic
1081479909 11:43476548-43476570 CTTGACTTCTGTGCACCCACAGG + Intronic
1081664265 11:44907275-44907297 CTGGATTCTTGGGCCCCCACAGG + Intronic
1081769028 11:45635890-45635912 CTTGACTTCTGTGCACCCACAGG - Intergenic
1082287782 11:50335568-50335590 CTTGACTTCTGTGCACCCACAGG + Intergenic
1082652086 11:55806270-55806292 CTTGACTTCTGTGTACCCACAGG + Intergenic
1083782470 11:64925491-64925513 CTGGACTCTTCGGGACCCCCAGG + Exonic
1085194332 11:74659128-74659150 CTTGACTCCTGTGCACCCGCAGG + Intronic
1085476379 11:76791745-76791767 CTTGACTTCTGTGTACCCACAGG - Exonic
1085505808 11:77058189-77058211 CAGGGACCCTGGGGACCCACAGG + Intergenic
1085593964 11:77791194-77791216 CTTGACTTCTGTGCACCCACAGG + Intronic
1086309321 11:85518949-85518971 CTTGACTTCTGTGCACCCACAGG - Intronic
1086323262 11:85672090-85672112 CTTGACTTCTGTGCACCCACAGG + Intronic
1086936103 11:92747249-92747271 CTTGACTTCTGTGCACCCACAGG + Intronic
1087447078 11:98268872-98268894 CTTGTCTCCTGTGCACCCACAGG + Intergenic
1087493847 11:98864062-98864084 CTTGACTTCTGTGCACCCACAGG + Intergenic
1087793642 11:102432928-102432950 CTTGACTTCTGTGCACCCACAGG - Intronic
1088038785 11:105351005-105351027 CTTGACTTCTGTGTACCCACAGG + Intergenic
1089128750 11:116195504-116195526 CTGGTTTCCTGGGGATTCACAGG - Intergenic
1089195914 11:116693973-116693995 CCGGCCTCCAAGGGACCCACAGG + Intergenic
1090077109 11:123586514-123586536 CTGGACTCATGCGGTCCCTCTGG + Intronic
1090402463 11:126457996-126458018 CTGGGCTCCTGGTGGCCCCCAGG + Intronic
1090633286 11:128669460-128669482 CTGCAGTCCTGGTGTCCCACGGG - Intergenic
1091139146 11:133220490-133220512 CTGGAGTCCTGGGGAGTCAGAGG + Intronic
1091148345 11:133300916-133300938 CTGTACTCCTGGAGACTCTCAGG - Intronic
1092003262 12:5048371-5048393 CTGGACTCCAGGGTTCCCTCTGG - Intergenic
1092444780 12:8544502-8544524 TGGGACTCGTGGGGCCCCACAGG + Intergenic
1092618185 12:10234560-10234582 CTTGACTTCTGTGCACCCACAGG + Intergenic
1092652217 12:10646919-10646941 CTTGACTTCTGTGTACCCACAGG - Intronic
1094489254 12:30948476-30948498 CTTGACTTCTGTGCACCCACAGG + Intronic
1095213989 12:39526981-39527003 CTGGACTTCTGTGCATCCACAGG + Intergenic
1095235008 12:39785379-39785401 CTTGACTTCTGTGCACCCACAGG - Intronic
1095623214 12:44283042-44283064 CTTGACTTCTGTGTACCCACAGG - Intronic
1095705344 12:45230885-45230907 TTGAACTCCTGGGGAACTACAGG - Intronic
1096864772 12:54555994-54556016 CTGGACTCCTAAGGCCCCAGAGG - Intronic
1097160517 12:57043449-57043471 CTGGTGTCCTGGGGTCTCACTGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097558165 12:61166472-61166494 CTTGACTTCTGTGCACCCACGGG + Intergenic
1098509181 12:71291782-71291804 CTTGACTTCTGTGCACCCACAGG + Intronic
1098830855 12:75360908-75360930 CTTGACTTCTGTGTACCCACAGG + Intronic
1098837713 12:75441974-75441996 CTTGACTTCTGTGTACCCACAGG - Intergenic
1099352570 12:81591709-81591731 CTTGACTTCTGTGCACCCACAGG - Intronic
1099390161 12:82069937-82069959 CTTGACTTCTGTGCACCCACAGG + Intergenic
1099492794 12:83307248-83307270 ATTGACTTCTGTGGACCCACAGG - Intergenic
1099655082 12:85479266-85479288 ATTGACTTCTGGGTACCCACAGG + Intergenic
1099707864 12:86180192-86180214 CTTGACTTCTGTGTACCCACAGG - Intronic
1100678455 12:96893461-96893483 CTTGACTTCTGTGCACCCACAGG - Intergenic
1101414735 12:104499317-104499339 CTGAGCTTCTGGGGCCCCACTGG - Intronic
1101516389 12:105439441-105439463 CTTGACTTCTGTGCACCCACAGG + Intergenic
1101663570 12:106788584-106788606 CTTGACTTCTGTGCACCCACAGG + Intronic
1102248887 12:111372346-111372368 CTTGACTTCTGTGCACCCACAGG + Intergenic
1102254446 12:111407442-111407464 CTGCATCCCTGGAGACCCACAGG - Intronic
1102794716 12:115678912-115678934 CTTGACTTCTGTGCACCCACAGG - Intergenic
1104959370 12:132480945-132480967 CTGCACCCCTAGGGACCCAGCGG + Intergenic
1106831952 13:33593552-33593574 CTGGAATAATGGAGACCCACAGG + Intergenic
1106864433 13:33948310-33948332 CTTGACTTCTGTGCACCCACAGG - Intronic
1108419474 13:50233903-50233925 CTTGACTTCTGTGCACCCACAGG - Intronic
1108736034 13:53284092-53284114 CTGGACTGATGGAGAGCCACTGG - Intergenic
1108850865 13:54727824-54727846 CTTGACTTCTGTGTACCCACAGG - Intergenic
1108933970 13:55864470-55864492 CTTGACTTCTGTGTACCCACAGG - Intergenic
1108936786 13:55891500-55891522 CTTGACTTCTGTGCACCCACAGG + Intergenic
1109334859 13:60981233-60981255 CTTGACTTCTGTGTACCCACAGG + Intergenic
1109416852 13:62051668-62051690 CTTGACTTCTGTGCACCCACAGG - Intergenic
1109641962 13:65202858-65202880 CTTGACTTCTGTGCACCCACAGG - Intergenic
1110038410 13:70718176-70718198 GTTGACTTCTGGGCACCCACAGG - Intergenic
1110044408 13:70810582-70810604 CTTGACTTCTGTGCACCCACAGG - Intergenic
1110566238 13:76959956-76959978 CTTGACTTCTGTGCACCCACAGG + Intergenic
1111218817 13:85178739-85178761 CTTGACTTCTGTGCACCCACAGG + Intergenic
1111271485 13:85892640-85892662 CTTGACTTCTGTGCACCCACAGG - Intergenic
1111472058 13:88695822-88695844 CTTGACTTCTGTGCACCCACAGG + Intergenic
1112857798 13:103792382-103792404 CTTGACTTCTGTGCACCCACAGG + Intergenic
1113284930 13:108836277-108836299 CTTGACTTCTGAGCACCCACAGG - Intronic
1113452905 13:110424746-110424768 TTGTACCCCTGGGGGCCCACTGG - Exonic
1114147450 14:19993917-19993939 CTTGACTTCTGTGCACCCACAGG + Intergenic
1114987683 14:28250995-28251017 CTTGACTTCTGTGCACCCACAGG + Intergenic
1115009091 14:28522516-28522538 CTTGACTTCTGTGCACCCACAGG - Intergenic
1115878778 14:37891871-37891893 CTTGACTTCTGTGCACCCACAGG - Intronic
1115968213 14:38915854-38915876 CTTGACTTCTGGGCACCCACAGG + Intergenic
1115990024 14:39141664-39141686 CTTGACTTCTGTGCACCCACAGG + Intergenic
1116079725 14:40156645-40156667 CTTGACTTCTGTGCACCCACAGG + Intergenic
1116154488 14:41186000-41186022 CTTGACTTCTGTGCACCCACAGG + Intergenic
1116164168 14:41311905-41311927 CTTGACTTCTGTGCACCCACAGG - Intergenic
1116340538 14:43717407-43717429 CTGGACACCTGGGTACTTACGGG + Intergenic
1116564899 14:46432499-46432521 CTTGACTTCTGTGCACCCACAGG + Intergenic
1116714164 14:48407060-48407082 CTTGACTTCTGTGCACCCACAGG + Intergenic
1117247004 14:53896538-53896560 CTGGTTTACTGGGGACCCAAGGG - Intergenic
1117427916 14:55620550-55620572 CTTGACTTCTGTGCACCCACAGG + Intronic
1117543652 14:56772534-56772556 CTGGACTATTGAGGACCCAAAGG - Intergenic
1117749234 14:58903121-58903143 CTTGACTTCTGTGCACCCACAGG - Intergenic
1117854189 14:60010276-60010298 CTTGACTTCTGTGTACCCACAGG + Intronic
1117907506 14:60605722-60605744 CTTGACTTCTGTGCACCCACAGG - Intergenic
1117908230 14:60612034-60612056 CTTGACTTCTGTGCACCCACAGG + Intergenic
1118046512 14:61976532-61976554 CTTGACTTCTGTGCACCCACAGG + Intergenic
1118239598 14:64043679-64043701 CTTGACTTCTGTGTACCCACAGG - Intronic
1118694992 14:68375969-68375991 GAGGACTCCTAGGGACCCAGGGG + Intronic
1118879000 14:69810368-69810390 CTGGAGCCCTGCAGACCCACAGG + Intergenic
1119040389 14:71269386-71269408 CTTGACTTCTGTGCACCCACAGG - Intergenic
1119099979 14:71870790-71870812 CTGGAATCCTGGGCCCACACTGG - Intergenic
1119423629 14:74522570-74522592 CTGGAGTCCTGGAGACTCATCGG + Intronic
1119450147 14:74702346-74702368 CTTGACTTCTGTGCACCCACAGG + Intronic
1119764993 14:77182376-77182398 CTGGGCTCCTGGGCCCCCAGGGG + Intronic
1119934003 14:78574103-78574125 CTTGACTTCTGTGCACCCACAGG - Intronic
1120152703 14:81055217-81055239 CTTGACTTCTGTGTACCCACAGG - Intronic
1120367012 14:83583561-83583583 CTTGACTTCTGTGTACCCACAGG - Intergenic
1120583224 14:86279819-86279841 CTTGACTTCTGTGCACCCACAGG - Intergenic
1120590956 14:86372764-86372786 CTTGACTTCTGTGCACCCACAGG - Intergenic
1120933801 14:89874133-89874155 CTTGACTTCTGTGTACCCACAGG + Intronic
1121020275 14:90575634-90575656 CTGGGCTCCTGGGGACAGGCTGG + Intronic
1121063452 14:90938620-90938642 CTTGACTTCTGTGTACCCACAGG + Intronic
1121128828 14:91427235-91427257 ATTGACTCCTGTGCACCCACAGG - Intergenic
1121147008 14:91593066-91593088 CTTGACTTCTGTGCACCCACAGG - Intronic
1121471916 14:94162452-94162474 ATGGAGTTCTGGGGACCCACAGG - Intronic
1122030386 14:98907646-98907668 CTGGGCTACTGGTGACCAACAGG + Intergenic
1122132689 14:99614245-99614267 CTGGGCTCCGGGGCACCCACAGG - Intergenic
1122143597 14:99676216-99676238 CTGCAGGCCTGGGGCCCCACTGG + Exonic
1122399941 14:101460970-101460992 CAGCATTGCTGGGGACCCACTGG + Intergenic
1122529821 14:102417885-102417907 CGGGAGTCCAGGGGAGCCACGGG + Intronic
1122756485 14:103984526-103984548 CTTGACTTCTGTGCACCCACAGG - Intronic
1122856191 14:104561285-104561307 CTGGACTCCAGCGCACCCACCGG + Intronic
1122906449 14:104803787-104803809 CTGGACGCCTGGAGACCACCTGG + Exonic
1123132442 14:105999592-105999614 CTGGTTTCCTGGGCACCCTCTGG + Intergenic
1123146826 14:106141312-106141334 CTGGTTTCCTGGGCACCCCCTGG + Intergenic
1123582662 15:21730726-21730748 CTGGTTTCCTGGGCACCCTCTGG + Intergenic
1123619312 15:22173322-22173344 CTGGTTTCCTGGGCACCCTCTGG + Intergenic
1123795606 15:23767148-23767170 CTTGACTTCTGTGCACCCACAGG - Intergenic
1124350961 15:28955291-28955313 ACAGACTGCTGGGGACCCACAGG - Intronic
1124506009 15:30274445-30274467 CAGGACTGCTGGGGAGGCACCGG + Intergenic
1124695831 15:31863480-31863502 CTTGACTTCTGTGTACCCACAGG + Intronic
1124737544 15:32264187-32264209 CAGGACTGCTGGGGAGGCACCGG - Intergenic
1125304223 15:38291609-38291631 CTTGACTTCTGTGCACCCACAGG + Intronic
1126104856 15:45140956-45140978 GGGGACTCCTGGAGAGCCACCGG + Exonic
1126474519 15:49051826-49051848 CTTGACTCCTGTTCACCCACAGG + Intergenic
1126825077 15:52540467-52540489 CTTGACTTCTGTGCACCCACAGG + Intergenic
1126942449 15:53781243-53781265 CTTGACTTCTGTGCACCCACAGG + Intergenic
1126943411 15:53791048-53791070 CTGGACAGCTGGGGACCCTCAGG + Intergenic
1127576261 15:60295275-60295297 CTTGACTTCTGTGCACCCACAGG + Intergenic
1128315922 15:66659372-66659394 CTGGCATCCTGGGTACCCACAGG - Intronic
1128941284 15:71789998-71790020 CTGGATTCTTTGGGTCCCACTGG - Intergenic
1129451216 15:75652309-75652331 CAGGCCTGCTGGGGGCCCACTGG + Intronic
1129628923 15:77235946-77235968 CTTGACTTCTGTGCACCCACAGG - Intronic
1129877815 15:78988310-78988332 CTCGACTCCTGGGCACACAGTGG + Intronic
1130938197 15:88487728-88487750 CTGGAGTCAGGGAGACCCACAGG + Intergenic
1131548073 15:93332672-93332694 CTGGACTTCTGGGTGCACACCGG - Intergenic
1132578095 16:673128-673150 CTGCGCTACTGGGTACCCACGGG - Exonic
1132578159 16:673382-673404 CTGGACTCACAGGGCCCCACAGG - Intronic
1132759237 16:1500866-1500888 CTGAGCTCCTGGGGCCACACAGG + Intronic
1135919040 16:26631819-26631841 CTTGACTTCTGTGCACCCACAGG + Intergenic
1136287311 16:29252220-29252242 CTGAGCCGCTGGGGACCCACTGG - Intergenic
1136373157 16:29848601-29848623 CTGGGCTCCTGGAGAACCAGTGG - Intergenic
1136518963 16:30784325-30784347 CTGGACTCTGGGGGACACCCGGG - Intronic
1136788186 16:32947682-32947704 AGGGCCTCCTGGGGTCCCACAGG - Intergenic
1136881598 16:33906107-33906129 AGGGCCTCCTGGGGTCCCACAGG + Intergenic
1139812772 16:69636577-69636599 CTTGACTTCTGTGCACCCACAGG + Intronic
1139982411 16:70870572-70870594 CTTGACTTCTGTGCACCCACAGG - Intronic
1141214204 16:82009063-82009085 CTTGACTTCTGTGTACCCACAGG - Intronic
1141273054 16:82558286-82558308 CTTGACTTCTGTGCACCCACAGG - Intergenic
1141300847 16:82814310-82814332 CTGGGCTCCTGGATACCCCCAGG + Intronic
1141689315 16:85587508-85587530 CTGGGCTCCTGGGGACACAGCGG + Intergenic
1142092926 16:88224849-88224871 CTGAGCCGCTGGGGACCCACTGG - Intergenic
1142228230 16:88887702-88887724 CTGGGCTCCTGGGGACAGAGTGG - Intronic
1142282640 16:89156600-89156622 CAGGACTCCTGGTGACCAGCTGG + Intergenic
1142319521 16:89372053-89372075 CAGTCCACCTGGGGACCCACTGG - Intronic
1142331749 16:89458878-89458900 CAGGACCCCTGAGGAACCACAGG - Intronic
1142380741 16:89730562-89730584 CTGCACTCCTGGGGTCCCAGAGG - Intronic
1142399027 16:89849618-89849640 CTGGCCACCTGGGGACCACCTGG + Intronic
1203090415 16_KI270728v1_random:1209339-1209361 AGGGCCTCCTGGGGTCCCACAGG - Intergenic
1143152632 17:4816877-4816899 CTGGACTCCTTGGGACACTTGGG - Intronic
1143993944 17:10990688-10990710 CTTGACTCCTGGGGACCCCCAGG - Intergenic
1144187293 17:12808475-12808497 CTTGACTTCTGTGCACCCACGGG + Intronic
1144508776 17:15857207-15857229 CTTGACTTCTGTGTACCCACAGG - Intergenic
1144739173 17:17571661-17571683 CTGGACTCCTGGGGAGCTGGGGG - Intronic
1145042232 17:19585460-19585482 CTGGTCTCATGGGGTCCCGCTGG + Intergenic
1145172893 17:20674847-20674869 CTTGACTTCTGTGTACCCACAGG - Intergenic
1146006167 17:29162048-29162070 CTGGGGTCTTGGTGACCCACTGG - Intronic
1146842297 17:36164370-36164392 CCGGACTCCTGGGAACCGGCAGG + Intergenic
1146854607 17:36252329-36252351 CCGGACTCCTGGGAACCGGCAGG + Intronic
1146866013 17:36336047-36336069 CCGGACTCCTGGGAACCGGCAGG - Intronic
1146870507 17:36376221-36376243 CCGGACTCCTGGGAACCGGCAGG + Intronic
1146877865 17:36427302-36427324 CCGGACTCCTGGGAACCGGCAGG + Intronic
1147068882 17:37936659-37936681 CCGGACTCCTGGGAACCGGCAGG - Intergenic
1147073390 17:37976845-37976867 CCGGACTCCTGGGAACCGGCAGG + Intergenic
1147080406 17:38016196-38016218 CCGGACTCCTGGGAACCGGCAGG - Intronic
1147084912 17:38056383-38056405 CCGGACTCCTGGGAACCGGCAGG + Intronic
1147096353 17:38140156-38140178 CCGGACTCCTGGGAACCGGCAGG - Intergenic
1147100859 17:38180349-38180371 CCGGACTCCTGGGAACCGGCAGG + Intergenic
1147148557 17:38499800-38499822 AGGGCCTCCTGGGGTCCCACAGG - Intronic
1147202381 17:38811629-38811651 CTGGACTTCTGTAGACCCAGAGG - Intronic
1147550326 17:41437393-41437415 CTGAATTCCTGTGGACCCACAGG - Exonic
1147998723 17:44375543-44375565 CCGGCCTCCCCGGGACCCACGGG - Intronic
1149051407 17:52309861-52309883 CTTGACTTCTGTGCACCCACAGG + Intergenic
1149845451 17:60006813-60006835 CCGGACTCCTGGGAACCAGCAGG + Intergenic
1149902365 17:60492155-60492177 CTTGACTTCTGGGCACCCACAGG - Intronic
1150083800 17:62263396-62263418 CCGGACTCCTGGGAACCGGCAGG + Intergenic
1150687379 17:67331649-67331671 CTTGACTTCTGTGCACCCACAGG - Intergenic
1150830902 17:68518432-68518454 CTTGACTTCTGTGCACCCACAGG + Intronic
1151086629 17:71388042-71388064 CTTGACTTCTGTGCACCCACAGG + Intergenic
1151875485 17:76865789-76865811 CTGGGAACCTGGGGAGCCACGGG + Intergenic
1151947392 17:77327173-77327195 CTGGGCTCCTGGGACCCCTCCGG + Intronic
1152224186 17:79085146-79085168 CTGGACTCCTGGGGCGCCCTTGG + Intronic
1153421917 18:4916645-4916667 CTTGACTTCTGTGTACCCACAGG + Intergenic
1153565500 18:6414395-6414417 CGGGACTCCTGAGGGCCCCCAGG - Intronic
1154383224 18:13871013-13871035 CTGGTCTCCTTGGGGCCCAAAGG - Intergenic
1154411671 18:14145188-14145210 CTGGAGGCCTGGGGGCCCTCAGG - Intergenic
1154506587 18:15046165-15046187 CTTGACTTCTGGGCATCCACAGG + Intergenic
1155327447 18:24679150-24679172 GAGGACTTCTGGGGATCCACGGG - Intergenic
1155516000 18:26624546-26624568 CTTGACTTCTGTGTACCCACAGG - Intronic
1155851696 18:30782608-30782630 CTTGACTTCTGTGCACCCACAGG - Intergenic
1156265909 18:35488397-35488419 CTTGACTTCTGTGCACCCACAGG + Intronic
1156373314 18:36490447-36490469 CTGGTTACCTTGGGACCCACTGG - Intronic
1158786715 18:60721625-60721647 CTTGACTTCTGTGCACCCACAGG + Intergenic
1159180280 18:64893477-64893499 CTTGACTTCTGTGTACCCACAGG + Intergenic
1159215567 18:65386987-65387009 CTTGACTTCTGTGAACCCACAGG - Intergenic
1159357764 18:67358856-67358878 CTTGACTTCTGCGCACCCACAGG - Intergenic
1160396984 18:78579952-78579974 TTGGAGTCCTGGGGACCCCTGGG - Intergenic
1160481511 18:79245036-79245058 CTGGGCTCCTAGGGACCCTGAGG + Intronic
1160490658 18:79334729-79334751 CTGGCCCCCAGGAGACCCACCGG + Intronic
1160535649 18:79590008-79590030 CAGCCCTCCTGGGGCCCCACAGG + Intergenic
1160599402 18:80001221-80001243 CTTGACTTCTGTGCACCCACAGG - Intronic
1160751160 19:735305-735327 CTGGATGTCTGGGGGCCCACAGG + Intronic
1160857670 19:1224639-1224661 CTTCCCTCCTGGGGACCCTCAGG + Intronic
1161099634 19:2415325-2415347 CTGCACTCCAGGAGACCCATGGG - Intronic
1161218055 19:3104588-3104610 CTGGAGTGCGGGGGACCCAATGG + Intronic
1162624439 19:11873207-11873229 CTGGAAAGCTGGGGATCCACAGG + Intronic
1162674669 19:12290046-12290068 CTGGAAATCTGGGGATCCACAGG - Intronic
1162988911 19:14289768-14289790 CTGGGGGCCTGGGGACTCACAGG - Intergenic
1163230089 19:15995812-15995834 CTTGACTTCTGTGCACCCACAGG - Intergenic
1163539700 19:17900517-17900539 CTTGACTTCTGTGCACCCACAGG - Intergenic
1163548027 19:17950811-17950833 CTCGGCTCCTGCGAACCCACCGG + Intergenic
1163551685 19:17969099-17969121 CTGGAGTCCCTGGGACCCTCAGG - Intronic
1163870525 19:19817540-19817562 CTGGAAAGCTGGGGATCCACAGG - Intronic
1163884522 19:19954105-19954127 CTGGAAAGCTGGGGCCCCACAGG - Intergenic
1163915034 19:20233776-20233798 CTGGAAAGCTGGGGCCCCACAGG - Intergenic
1163948538 19:20563200-20563222 CTGGAAAGCTGGGGCCCCACAGG - Intronic
1163969571 19:20779075-20779097 CTGGAAAGCTGGGGTCCCACAGG + Intronic
1163993799 19:21024225-21024247 CTGGAAAGGTGGGGACCCACAGG + Intronic
1163999672 19:21085742-21085764 CTGGAAAGCTGAGGACCCACAGG + Intronic
1164005596 19:21145594-21145616 CTGGAAAGCTGGGGACCCACAGG + Intronic
1164022816 19:21323725-21323747 CTGGAAAGCTGGGGACCCACAGG - Intronic
1164042931 19:21509656-21509678 CTGGAAAGCTGGGAACCCACAGG + Intronic
1164048657 19:21564966-21564988 CTGGAAAGCTGGGGACCCACAGG - Intergenic
1164080060 19:21854500-21854522 CTGGAAAGCTGGGGACCCACAGG + Intergenic
1164095518 19:22006539-22006561 CTGGAAAGCTGGGGCCCCACAGG - Intronic
1164114987 19:22211224-22211246 CTGGAAAGCTGGGGCCCCACAGG - Intergenic
1164176502 19:22780020-22780042 CTGGAAAGCTGGGGACCCACAGG - Intronic
1164183032 19:22836241-22836263 CTGGAAAGCTGGGGACCCTCAGG + Intergenic
1164283828 19:23792388-23792410 TTGGAATGCTGGGGATCCACAGG + Intronic
1164414081 19:28031645-28031667 CTTGACTTCTGTGCACCCACAGG + Intergenic
1164541464 19:29124511-29124533 CTTGACTTCTGTGTACCCACAGG + Intergenic
1166213956 19:41323853-41323875 CGGGACGCCTGGGTTCCCACAGG - Exonic
1166381970 19:42359331-42359353 CTGGGCCCCTGCAGACCCACTGG + Intronic
1166794851 19:45420036-45420058 CTGGACTCCTGGGGATCTGAGGG - Intronic
1168284344 19:55322964-55322986 TTGGACTCCTGGGTCCCCAAGGG - Intronic
925001214 2:404178-404200 CTTGACTTCTGTGCACCCACAGG + Intergenic
925245596 2:2379762-2379784 CTTGACTTCTGTGCACCCACAGG - Intergenic
925291933 2:2753820-2753842 CTTGACTTCTGTGTACCCACAGG - Intergenic
925362439 2:3288918-3288940 CTGGCCCCCTGGGCAGCCACAGG + Intronic
925495325 2:4441962-4441984 CTGGGCACCTGGGAACCCAGGGG - Intergenic
925868242 2:8247457-8247479 CTGGACTCCTAAGGACCCAGAGG - Intergenic
925911752 2:8578339-8578361 GAGGACTCCTGGGGACCCCAAGG + Intergenic
926431037 2:12785941-12785963 CTTGACTTCTGTGCACCCACAGG + Intergenic
926514276 2:13821753-13821775 ATGGACAGCTGGGCACCCACAGG + Intergenic
926597694 2:14809494-14809516 CTTGACTTCTGTGCACCCACAGG - Intergenic
926621352 2:15049454-15049476 CAGGAGGCCTGGGGTCCCACAGG - Intergenic
926734620 2:16063457-16063479 CTTGACTTCTGTGTACCCACAGG + Intergenic
926926488 2:17993285-17993307 CTTGACTTCTGTGCACCCACAGG - Intronic
926947434 2:18203529-18203551 CTTGACTTCTGTGCACCCACAGG - Intronic
927146500 2:20169626-20169648 CAGGAAACCTGTGGACCCACTGG + Intergenic
928065572 2:28161300-28161322 CTAGACTCCTGGAGCCCCCCAGG - Intronic
928090069 2:28368493-28368515 CTGGATTGCAGGGGACACACTGG - Intergenic
928609918 2:32982766-32982788 CTTGACTTCTGTGCACCCACAGG - Intronic
929244796 2:39689808-39689830 CTGGACTCCTGAGTTACCACAGG - Intronic
929528825 2:42732301-42732323 CTTGACTTCTGTGCACCCACAGG + Intronic
929825429 2:45305997-45306019 CTGGGCTCCTGGGCCTCCACAGG + Intergenic
930230128 2:48834986-48835008 CTTGACTTCTGTGCACCCACAGG - Intergenic
930942130 2:57025841-57025863 CTTGACTTCTGTGCACCCACAGG + Intergenic
930960343 2:57253170-57253192 CTTGACTTCTGTGTACCCACAGG - Intergenic
931033510 2:58211228-58211250 CTGGACTTCTGTGCACCCACAGG + Intronic
931079445 2:58752867-58752889 CTTGACTTCTGTGGACCCACAGG - Intergenic
931949839 2:67350144-67350166 CTTGACTTCTGTGCACCCACAGG + Intergenic
933181301 2:79230425-79230447 CTTGACTTCTGTGTACCCACAGG - Intronic
933344504 2:81066082-81066104 CTTGACTTCTGTGTACCCACAGG + Intergenic
933350391 2:81145883-81145905 CTTGACTTCTGCGCACCCACAGG + Intergenic
933445737 2:82377747-82377769 CTGGACTTCTGTGTACCCGCAGG - Intergenic
933947195 2:87296939-87296961 CTTGACTTCTGTGCACCCACAGG + Intergenic
934503388 2:94875238-94875260 CAGGACTCTTGGGGACCTCCCGG - Intronic
935359545 2:102235868-102235890 CTAGACCAGTGGGGACCCACGGG + Intronic
935385227 2:102492431-102492453 CTTGACTTCTGTGCACCCACAGG + Intronic
935497047 2:103794304-103794326 CTTGACTTCTGTGCACCCACAGG + Intergenic
935545554 2:104396219-104396241 CTGGCCTCCTGGGGACACAAGGG - Intergenic
936332997 2:111564629-111564651 CTTGACTTCTGTGCACCCACAGG - Intergenic
936549789 2:113427313-113427335 CTTGACTTCTGTGCACCCACAGG - Intergenic
937142442 2:119613494-119613516 CTGGACTTCTGTGCACCTACAGG + Intronic
937427644 2:121813453-121813475 CTTGACTTCTGTGCACCCACAGG - Intergenic
937561001 2:123223797-123223819 CTTGACTTCTGTGCACCCACAGG + Intergenic
937800605 2:126076932-126076954 CTTGACTTCTGTGCACCCACAGG - Intergenic
937806500 2:126151258-126151280 CTTGACTTCTGTGCACCCACAGG + Intergenic
938321613 2:130370092-130370114 CAGGACTGCTGGGGACCCCACGG - Exonic
938686387 2:133742228-133742250 CTTGACTTCTGTGCACCCACAGG + Intergenic
938774094 2:134525832-134525854 CTGGACTACTGGACACCCCCAGG - Intronic
938850018 2:135250705-135250727 CTTGACTTCTGTGCACCCACAGG - Intronic
938859827 2:135356825-135356847 CTGGAGTCCTGGCTACCCAGGGG - Intronic
939016896 2:136913718-136913740 CTTGACTTCTGAGTACCCACAGG - Intronic
939092061 2:137791138-137791160 CTTGACTTCTGTGCACCCACAGG + Intergenic
940052951 2:149483121-149483143 GTGGACCCCAGGGGACCCACTGG + Intergenic
940279184 2:151971930-151971952 CTGTACTCCTGGTGACTCAGTGG - Intronic
940484087 2:154275515-154275537 CTTGACTTCTGTGAACCCACAGG - Intronic
940547168 2:155102455-155102477 CTTGACTTCTGTGCACCCACAGG + Intergenic
940621729 2:156121689-156121711 CTTGACTTCTGTGCACCCACAGG - Intergenic
941307778 2:163892324-163892346 CTTGACTTCTGTGCACCCACAGG + Intergenic
941445213 2:165591726-165591748 CTTGACTTCTGGGTACCCACAGG - Intronic
942131552 2:172885219-172885241 CTGTCCTGCTGGGGACCCACTGG - Intronic
942380514 2:175386027-175386049 CTTGACTTCTGTGCACCCACAGG - Intergenic
942419970 2:175797420-175797442 CTTGACTTCTGTGCACCCACAGG - Intergenic
942648234 2:178138132-178138154 GTGGACTCATGAGAACCCACAGG - Intronic
943072206 2:183153972-183153994 CTTGACTTCTGTGCACCCACAGG + Intronic
943478193 2:188385241-188385263 CTTGACTTCTGGGCATCCACAGG + Intronic
943483960 2:188456500-188456522 CTTGACTTCTGTGCACCCACAGG - Intronic
943804908 2:192111923-192111945 CTTGACTTCTGTGCACCCACAGG - Intronic
944272217 2:197796415-197796437 CTTGACTTCTGTGGGCCCACAGG + Intergenic
944669926 2:201986116-201986138 CTGGGGTCCCGGGGGCCCACAGG - Intergenic
946171851 2:217900365-217900387 CTGCAGTCCGGGGGACCCAGAGG + Intronic
946844890 2:223850476-223850498 CTTGACTTCTGTGCACCCACAGG - Intergenic
947396686 2:229694161-229694183 CTTGACTTCTGTGCACCCACAGG - Intronic
948338939 2:237233676-237233698 TTGGCCTCCTGAGGACCCAAAGG + Intergenic
948346544 2:237303608-237303630 CTTGACTTCTGTGCACCCACAGG - Intergenic
948520183 2:238531603-238531625 CTTGACTCCTGTACACCCACAGG - Intergenic
948841006 2:240648904-240648926 CTGAGATCCTGGGGACCCAAAGG - Intergenic
1169119128 20:3084801-3084823 GTGGGCTCCTGGGGAGCCACTGG - Intergenic
1169593940 20:7176822-7176844 CTTGACTTCTGTGCACCCACAGG + Intergenic
1169622030 20:7518057-7518079 CAGGTCTCCTGGGGTCTCACTGG - Intergenic
1169766415 20:9152531-9152553 CTTGACTTCTGTGCACCCACAGG - Intronic
1169999250 20:11596541-11596563 CTTGACTTCTGTGCACCCACAGG + Intergenic
1170037515 20:12004711-12004733 CTTGACTTCTGTGGACCCACAGG - Intergenic
1170475012 20:16706099-16706121 CTTGACTTCTGTGCACCCACAGG - Intergenic
1170643883 20:18179470-18179492 CTGGACTTCTGTGCACCCTCAGG + Intronic
1170741822 20:19065154-19065176 CTTGACTTCTGTGCACCCACAGG - Intergenic
1171179868 20:23084561-23084583 CCAGACGCCTGGGGACCCACTGG + Exonic
1171248466 20:23632026-23632048 CTGGCCTCATGGGGGCCCAAGGG + Intronic
1171749920 20:29038771-29038793 CTTGACTTCTGTGCACCCACAGG + Intergenic
1172893186 20:38281558-38281580 CTTGACTTCTGTGTACCCACAGG + Intronic
1173027145 20:39318971-39318993 CTGGACTCCTTGTGTCCTACTGG + Intergenic
1173616148 20:44404039-44404061 CTGCACTCCTGGGGACACCTGGG + Intronic
1174661955 20:52221198-52221220 CTTGACTTCTGTGCACCCACAGG + Intergenic
1175008489 20:55710823-55710845 CTTGACTTCTGTGTACCCACAGG - Intergenic
1175186099 20:57180414-57180436 CTGGCCTCGTGGGCACCCACTGG + Intronic
1175195378 20:57239733-57239755 CTTGACTTCTGTGCACCCACAGG + Intronic
1175872492 20:62215111-62215133 CTGCACGCCTTGGGACCCTCGGG + Exonic
1175999141 20:62824352-62824374 GTGGCCTCCTGGGGTCCCGCGGG + Intronic
1176091065 20:63318861-63318883 CTGGGCTCCTAGGGAGCCAGCGG + Intronic
1176125124 20:63471783-63471805 CGGGACTCTCGGGGACCCGCGGG - Intronic
1176315305 21:5237145-5237167 CTTGACTTCTGTGCACCCACAGG - Intergenic
1176791277 21:13322942-13322964 CTTGACTTCTGGGCATCCACAGG - Intergenic
1176861390 21:14013239-14013261 CTGGAGGCCTGGGGGCCCTCAGG + Intergenic
1177212341 21:18086953-18086975 ATGGACTGCTTGGGTCCCACTGG - Intronic
1177401740 21:20614043-20614065 CTTGACTTCTGTGCACCCACAGG - Intergenic
1177485029 21:21746016-21746038 CTTGACTTCTGTGCACCCACAGG - Intergenic
1177599227 21:23289130-23289152 CTTGACTTCTGTGCACCCACAGG - Intergenic
1177854209 21:26383518-26383540 CTTGACTTCTGTGCACCCACAGG - Intergenic
1177918737 21:27124117-27124139 CTTGATTTCTGGGCACCCACAGG + Intergenic
1177990516 21:28030429-28030451 CTTGACTTCTGGGCATCCACAGG + Intergenic
1178634227 21:34288322-34288344 CTTGACTTCTGTGCACCCACAGG + Intergenic
1179316423 21:40247950-40247972 CTTGACTTCTGTGCACCCACAGG + Intronic
1179584755 21:42367447-42367469 CAGGAGTCCAGGGGACCAACTGG - Intergenic
1179909246 21:44439197-44439219 CTGCAGCCCTGGGGACACACAGG - Intronic
1179965300 21:44801557-44801579 CGGCACTCCGCGGGACCCACAGG + Intronic
1180158873 21:45990255-45990277 CAGGGCTCCAGGGGACCCAAGGG + Exonic
1180393090 22:12303100-12303122 CTTGACTTCTGTGCACCCACAGG - Intergenic
1180406660 22:12561668-12561690 CTTGACTTCTGTGCACCCACAGG + Intergenic
1180791742 22:18578485-18578507 CTGGGCTCCTGGGGAAGCCCGGG + Intergenic
1180929402 22:19578810-19578832 CTGGTCTCCTGGGGACCGAGCGG - Intergenic
1181055548 22:20259027-20259049 CTGGACACCTGAGGCCCCAGTGG - Intronic
1181229994 22:21416824-21416846 CTGGGCTCCTGGGGAAGCCCGGG - Intergenic
1181248655 22:21518042-21518064 CTGGGCTCCTGGGGAAGCCCGGG + Intergenic
1181287709 22:21766287-21766309 CTGGCCTCCTGGGGAAGCAAGGG + Intronic
1181341297 22:22182138-22182160 GTGGGCTCCTGGGGAGCCTCAGG + Intergenic
1181341309 22:22182177-22182199 GTGGGCTCCTGGGGAGCCTCAGG + Intergenic
1181524154 22:23469566-23469588 CTGCACCCCTGGGCACACACCGG + Intergenic
1181560860 22:23698750-23698772 CTGGAATCCTGGGTCCCCAGTGG - Intronic
1181635580 22:24172887-24172909 CTAGAGTCCTGGGAACCAACAGG - Intronic
1181745580 22:24953119-24953141 CTGGAGGCCTGGGGTCCCACTGG + Intronic
1182330173 22:29546047-29546069 CTTGACTTCTGTGCACCCACAGG + Intronic
1183004495 22:34890009-34890031 CTTGACTTCTGTGCACCCACAGG - Intergenic
1184839874 22:47046367-47046389 CTAGACTGCCAGGGACCCACAGG - Intronic
1184978540 22:48080325-48080347 CTGGAGTTCTGGGGTCCAACTGG - Intergenic
1185239662 22:49735761-49735783 CAGGCCTTGTGGGGACCCACAGG - Intergenic
1185366533 22:50439442-50439464 CTGGAGGCCTGGGGGCCCTCAGG + Intronic
949464411 3:4329414-4329436 CTTGACTTCTGTGTACCCACAGG + Intronic
949673307 3:6424642-6424664 CTTGACTACTGTGTACCCACAGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950490097 3:13299459-13299481 CAGGAGTCCTGGGGCCCCAAAGG + Intergenic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950913207 3:16616423-16616445 CTCGACTTCTGTGTACCCACAGG - Intronic
951317564 3:21205300-21205322 CTTGACTTCTGTGCACCCACAGG - Intergenic
951637325 3:24793974-24793996 CTGCACTCCTGCTGACCCTCAGG + Intergenic
952198499 3:31101230-31101252 CTTGACTTCTGTGTACCCACAGG + Intergenic
952324614 3:32309739-32309761 CTGGACTTCTGATGAACCACAGG - Intronic
952715084 3:36472125-36472147 CTTGACTTCTGTGCACCCACAGG + Intronic
953205413 3:40823407-40823429 CTGACTTCCTGGGGACCCAGTGG + Intergenic
956910034 3:73807643-73807665 CTTGACTTCTGTGCACCCACAGG - Intergenic
957457646 3:80472832-80472854 CTTGACTTCTGTGCACCCACAGG - Intergenic
957470615 3:80653710-80653732 CTTGACTTCTGTGCACCCACAGG - Intergenic
957630526 3:82711251-82711273 CTTGACTTCTGTGCACCCACAGG + Intergenic
957675410 3:83357711-83357733 CTTGACTCCTGTGCACCCACAGG + Intergenic
957873107 3:86112693-86112715 CTTGACTTCTGTGCACCCACAGG - Intergenic
957896328 3:86424950-86424972 CTTGACTTCTGTGCACCCACAGG + Intergenic
958537715 3:95425411-95425433 CTTGACTTCTGTGCACCCACAGG + Intergenic
958588162 3:96118079-96118101 CTTGACTTCTGTGCACCCACAGG - Intergenic
958860246 3:99437150-99437172 CTTGACTTCTGTGCACCCACAGG - Intergenic
959742566 3:109737491-109737513 CTTGACTTCTGTGTACCCACAGG + Intergenic
959838610 3:110949222-110949244 CTTGACTTCTGTGCACCCACAGG + Intergenic
960038390 3:113124567-113124589 CTTGTCTGCTGGGGACCCAGTGG - Intergenic
960473205 3:118093292-118093314 CTTGACTTCTGTGCACCCACAGG - Intergenic
960718702 3:120604160-120604182 CTGGAGTCCAGGGGATTCACTGG - Intergenic
961789365 3:129364810-129364832 CTTGACTTCTGTGCACCCACAGG + Intergenic
962461009 3:135612703-135612725 CTTGACTTCTGTGCACCCACAGG - Intergenic
962576918 3:136763386-136763408 CTTGACTTCTGTGCACCCACAGG - Intergenic
962769954 3:138602873-138602895 CTCGACTTCTGTGCACCCACAGG - Intergenic
963394568 3:144715414-144715436 CTTGACTTCTGTGCACCCACCGG + Intergenic
963422089 3:145073374-145073396 CTTGACTTCTGTGCACCCACAGG + Intergenic
964090862 3:152874131-152874153 CTTGACTTCTGTGCACCCACAGG + Intergenic
964098605 3:152962708-152962730 CTTGACTTCTGTGCACCCACAGG + Intergenic
964605524 3:158556290-158556312 CTTGACTTCTGTGCACCCACAGG - Intergenic
964654552 3:159052086-159052108 CTTGACTTCTGTGCACCCACAGG - Intronic
964912647 3:161801151-161801173 CTTGACTTCTGTGCACCCACAGG + Intergenic
965045495 3:163572381-163572403 CTTGACTTCTGTGTACCCACAGG - Intergenic
965251537 3:166349844-166349866 CTTGACTCCTGTGCACCCTCAGG - Intergenic
965386890 3:168056251-168056273 CTTGACTTCTGTGCACCCACAGG - Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
965795322 3:172433108-172433130 CTTGACTTCTGTGCACCCACAGG + Intergenic
966741981 3:183242560-183242582 CTTGACTTCTGTGAACCCACAGG - Intronic
967118450 3:186362111-186362133 CTGGTCTCCGCGGCACCCACTGG - Exonic
967406198 3:189118740-189118762 CTTGACTTCTGTGTACCCACAGG - Intronic
967509425 3:190292253-190292275 CTTGACTTCTGTGGACTCACAGG + Intergenic
967810401 3:193755080-193755102 CTTGACTTCTGTGCACCCACAGG - Intergenic
967908309 3:194520122-194520144 CTTGACTTCTGTGCACCCACAGG - Intergenic
967995664 3:195164522-195164544 CTGGATTCCAAGGGACCCAGTGG - Intronic
968295129 3:197570655-197570677 CTTGACTTCTGTGCACCCACAGG - Intronic
968590455 4:1456418-1456440 CTTGACTTCTGTGTACCCACAGG + Intergenic
968607731 4:1543395-1543417 CTGGAGACCTGGGGTCCCAAGGG + Intergenic
968661485 4:1800553-1800575 CAGGCCTCCTGGAGACCCCCAGG - Intronic
970339153 4:15086276-15086298 CTTGACTTCTGTGTACCCACAGG + Intergenic
970440548 4:16077747-16077769 CTGGATTGCTGGGGCCCCAGTGG - Intronic
970624409 4:17861288-17861310 CTTGACTTCTGTGCACCCACAGG + Intronic
970678273 4:18477355-18477377 CTTGACTCCTGTGCACCCATGGG + Intergenic
970818944 4:20190725-20190747 CTTGACTTCTGTGTACCCACAGG - Intergenic
970987641 4:22176781-22176803 CCTGACTTCTGGGCACCCACAGG + Intergenic
971649712 4:29256681-29256703 CTTGACTTCTGTGTACCCACAGG - Intergenic
972225307 4:37005229-37005251 CTTGATTTCTGGGCACCCACAGG - Intergenic
972756952 4:42057389-42057411 CTTGACTTCTGTGCACCCACAGG + Intronic
973032384 4:45360660-45360682 CTTGACTTCTGTGCACCCACAGG - Intergenic
974071438 4:57127691-57127713 CTTGACTTCTGTGCACCCACAGG - Intergenic
974269613 4:59633470-59633492 CTTGACTCCTGTGTACTCACAGG + Intergenic
974494962 4:62614918-62614940 CTTGACTTCTGTGCACCCACAGG + Intergenic
975307341 4:72865349-72865371 CTTGACTTCTGTGCACCCACAGG - Intergenic
975312011 4:72913615-72913637 CTTGACTTCTGTGCACCCACAGG - Intergenic
975367228 4:73544075-73544097 CTGGAATGCGGGGGACCCAGGGG + Intergenic
975878261 4:78869180-78869202 CTTGACTTCTGTGCACCCACAGG + Intronic
976128040 4:81854417-81854439 CTTGACTTCTGGGCACCCACAGG + Intronic
976405608 4:84658156-84658178 CTTGACTTCTGCGCACCCACAGG + Intergenic
976952467 4:90850147-90850169 CTTGACTCCTGTACACCCACAGG - Intronic
977014669 4:91677950-91677972 CTTGACTTCTGTGCACCCACAGG - Intergenic
977702513 4:100036191-100036213 CTTGACTTCTGTGCACCCACAGG + Intergenic
978330921 4:107611873-107611895 CTTGACTACTGTGCACCCACAGG - Intronic
978904052 4:113985471-113985493 CTTGACTTCTGTGTACCCACAGG - Intergenic
978939070 4:114415518-114415540 CTTGACTTCTGTGCACCCACAGG - Intergenic
979125618 4:116968807-116968829 CTTGACTTCTGTGCACCCACAGG + Intergenic
979137510 4:117128009-117128031 CTTGACTTCTGTGCACCCACAGG - Intergenic
979426413 4:120572591-120572613 CTTGACTTCTGTGCACCCACAGG + Intergenic
979984381 4:127295949-127295971 CTTGACTTCTGTGCACCCACAGG + Intergenic
980083606 4:128369251-128369273 CTTGACTTCTGTGGACCCGCAGG + Intergenic
980201302 4:129658866-129658888 CTTGACTTCTGTGCACCCACAGG + Intergenic
980324473 4:131324051-131324073 CTTGACTTCTGTGTACCCACAGG - Intergenic
980420497 4:132553491-132553513 CTGGAGTTCTGTGGAACCACAGG - Intergenic
980430160 4:132683976-132683998 CTTGACTCCTATGTACCCACAGG + Intergenic
980850416 4:138374307-138374329 CTTGACTCCTGTGTCCCCACAGG + Intergenic
981061686 4:140431853-140431875 CTCAACTTCTGGGTACCCACAGG - Intergenic
981121001 4:141051047-141051069 CTTGACTTCTGTGCACCCACAGG + Intronic
981242387 4:142493119-142493141 CTTGACTTCTGTGCACCCACAGG - Intronic
981281680 4:142966248-142966270 CTTGACTTCTGTGAACCCACAGG + Intergenic
981359624 4:143831583-143831605 CTTGACTTCTGTGCACCCACAGG - Intergenic
981370384 4:143952652-143952674 CTTGACTTCTGTGCACCCACAGG - Intergenic
981380142 4:144062576-144062598 CTTGACTTCTGTGCACCCACAGG - Intergenic
982076004 4:151737840-151737862 CTTGACTTCTGTGCACCCACAGG - Intronic
982104168 4:151997410-151997432 CAGGTCTGCTGGAGACCCACAGG + Intergenic
983048161 4:163011365-163011387 CTTGACTTCTGTGCACCCACAGG + Intergenic
983723846 4:170893570-170893592 CTGGACTTCTGTGGATTCACAGG + Intergenic
984512274 4:180693417-180693439 CTTGACTTCTGTGCACCCACAGG + Intergenic
984757176 4:183335911-183335933 CTGGACACATGGGGAGCCAAAGG - Intergenic
985431827 4:189888421-189888443 CTTGACTTCTGTGCACCCACAGG + Intergenic
985634782 5:1030677-1030699 CTGGGCTCATGGGGCCCCTCAGG + Intronic
985767498 5:1787625-1787647 CTGCCCTCCCGGGGACCCAGTGG - Intergenic
986113934 5:4750641-4750663 CTTGACTTCTGTGCACCCACAGG + Intergenic
986455302 5:7912355-7912377 CTTGACTTCTGTGCACCCACAGG + Intergenic
986768031 5:10945887-10945909 CTGGAGTCCAGGGGGCCCAGAGG + Intergenic
987102588 5:14605171-14605193 CTTGACTTCTGTGTACCCACAGG + Intronic
987216579 5:15743836-15743858 CTTGACTTCTGTGGACCCACAGG + Intronic
987799505 5:22675340-22675362 CTTGACTTCTGTGCACCCACAGG - Intronic
987826300 5:23034715-23034737 CTTGACTTCTGTGCACCCACGGG + Intergenic
987894343 5:23925621-23925643 CTTGACTTCTGTGCACCCACAGG + Intergenic
988379422 5:30481109-30481131 CTTGACTTCTGTGCACCCACAGG + Intergenic
988386580 5:30573745-30573767 CTTGCCTTCTGGGCACCCACAGG - Intergenic
989218308 5:38927441-38927463 CTTGACTTCTGTGCACCCACAGG + Intronic
989224555 5:39011258-39011280 CTTGACTTCTGTGCACCCACAGG - Intronic
989351244 5:40489146-40489168 CTGAACTCATGGGAACTCACAGG + Intergenic
989389188 5:40882644-40882666 CTTGACTTCTGCGCACCCACAGG - Intergenic
991039183 5:62158735-62158757 CTTGACTTCTGTGTACCCACAGG - Intergenic
991130415 5:63116457-63116479 CAGGACTTGTGGGGATCCACAGG - Intergenic
991168957 5:63598575-63598597 CTGGCCTCCTGGGGGCTCTCAGG + Intergenic
991340320 5:65601761-65601783 CTTGACTTCTGTGCACCCACAGG + Intronic
991535919 5:67669296-67669318 CTTGACTTCTGTGCACCCACAGG - Intergenic
993098267 5:83505868-83505890 CTTGACTTCTGTGCACCCACAGG + Intronic
993257888 5:85616829-85616851 CTAGACTTCTGTGTACCCACCGG + Intergenic
993743314 5:91565381-91565403 CTTGACTTCTGTGCACCCACAGG + Intergenic
994018977 5:95002111-95002133 CTTGACTTCTGTGCACCCACAGG - Intronic
994338773 5:98600928-98600950 CTTGACTTCTGTGTACCCACAGG - Intergenic
994440803 5:99800605-99800627 CTTGACTTCTGTGCACCCACAGG + Intergenic
994689530 5:102999671-102999693 CTTGACTTCTGTGCACCCACAGG + Intronic
994755635 5:103790476-103790498 CTTGACTTCTGTGGACTCACGGG + Intergenic
994808249 5:104479362-104479384 CTTGACTTCTGTGCACCCACAGG - Intergenic
994823320 5:104680715-104680737 CTTGACTTCTGTGCACCCACAGG - Intergenic
994833016 5:104810179-104810201 CTTGACTTCTGTGCACCCACAGG + Intergenic
994900433 5:105762757-105762779 CTTGACTTCTGGGTATCCACAGG + Intergenic
995120666 5:108532541-108532563 CTTGACTTCTGTGCACCCACAGG + Intergenic
995370137 5:111409271-111409293 CTTGACTTCTGTGCACCCACAGG + Intronic
995390983 5:111640010-111640032 CTTGACTTCTGTGTACCCACAGG - Intergenic
995468716 5:112478229-112478251 CTAGGATCCTGGGGACCCACTGG - Intergenic
995997867 5:118322768-118322790 CTTGACTTCTGTGCACCCACAGG + Intergenic
996480907 5:123973911-123973933 CTTGACTTCTGGGCACCCGCAGG + Intergenic
996617394 5:125457972-125457994 CTTGACTTCTGTGTACCCACAGG - Intergenic
996911380 5:128660649-128660671 CTTGACTTCTGTGCACCCACAGG - Intronic
997056666 5:130452152-130452174 CTTGACTTCTGTGTACCCACAGG + Intergenic
997057349 5:130460188-130460210 CTTGACTTCTGTGTACCCACAGG - Intergenic
997181420 5:131832715-131832737 CTTGACTTCTGTGCACCCACAGG + Intronic
997476326 5:134144615-134144637 CTGGGCTCTTGGGCTCCCACTGG + Intronic
997651343 5:135523718-135523740 CTTGACTTCTGTGCACCCACAGG + Intergenic
997879551 5:137577300-137577322 CTGGAGTCCTGCAGACACACTGG + Intronic
998576664 5:143324317-143324339 CTTGACTTCTGTGTACCCACAGG + Intronic
998722983 5:144975506-144975528 CTTGACTGCTGTGTACCCACAGG - Intergenic
998926070 5:147127775-147127797 CTTGACTTCTGTGCACCCACTGG + Intergenic
999119950 5:149201487-149201509 ATGGACTCCCGGGGAGCCCCTGG - Intronic
999205134 5:149842194-149842216 CTGGCTTCCTGGGGCCCCTCTGG - Intronic
999668134 5:153934560-153934582 CTTGACTTCTGTGTACCCACAGG + Intergenic
999804894 5:155072154-155072176 CTTGACTTCTGTGCACCCACAGG + Intergenic
1000226528 5:159266847-159266869 CTTGACTTCTGTGTACCCACAGG - Intronic
1000232198 5:159326627-159326649 CAGGACTCTTGGGCAGCCACTGG - Intronic
1000784636 5:165528562-165528584 CTTGACTTCTGTGCACCCACAGG - Intergenic
1001280527 5:170383212-170383234 CTGGTTTCCTGGGGAGTCACCGG + Intronic
1002409181 5:179060627-179060649 CTGGACTGCCGGAGACCCGCGGG + Exonic
1002751724 6:119731-119753 CTGGACTTCTGTGAATCCACAGG + Intergenic
1002818250 6:698350-698372 CTGGAATGCAGGGGACTCACTGG + Intergenic
1003230034 6:4243558-4243580 CTTGACTTCTGTGCACCCACAGG + Intergenic
1003383879 6:5649800-5649822 ATAGACTGATGGGGACCCACAGG + Intronic
1003950175 6:11109322-11109344 CTGGACTCCAGTGGGTCCACTGG + Intronic
1004245621 6:13972696-13972718 CTCGACTTCTGTGCACCCACAGG - Intronic
1005982990 6:30851731-30851753 CTTGACTTCTGTGCACCCACAGG - Intergenic
1006113959 6:31765586-31765608 CTGGCCTCCTGGTGACACAACGG - Exonic
1006697137 6:35940747-35940769 CTTGACTTCTGTGCACCCACAGG - Intergenic
1007652470 6:43432127-43432149 CTGGACTCCTGGGGACAAGGGGG - Exonic
1007710970 6:43824080-43824102 AGGGGCTCCTGGGGATCCACAGG + Intergenic
1007762541 6:44141474-44141496 CTGGACTCCTTGGAATCCACTGG - Intronic
1007889298 6:45271499-45271521 CTTGACTTCTGTGCACCCACAGG - Intronic
1009550764 6:65088981-65089003 CTTGACTTCTGTGCACCCACAGG - Intronic
1009693743 6:67069273-67069295 CTTGACTTCTGTGCACCCACAGG - Intergenic
1009723474 6:67506369-67506391 CTTGACTTCTGTGCACCCACAGG + Intergenic
1009732172 6:67622380-67622402 CTTGACTTCTGTGCACCCACAGG - Intergenic
1010242759 6:73631786-73631808 CTGGAGACCTTGGGCCCCACAGG + Intronic
1010263752 6:73845045-73845067 CTTGACTTCTGTGTACCCACAGG - Intergenic
1010551029 6:77222651-77222673 CTTGACTTCTGTGCACCCACAGG - Intergenic
1011031730 6:82931162-82931184 CTTGACTTCTGTGTACCCACAGG - Intronic
1011041153 6:83031910-83031932 CTTGACTTCTGTGCACCCACAGG - Intronic
1011211216 6:84958567-84958589 CTTGACTTCTGTGCACCCACAGG - Intergenic
1011382724 6:86760045-86760067 CTTGACTTCTGTGTACCCACAGG - Intergenic
1011792716 6:90915595-90915617 CTTGACTTCTGTGCACCCACAGG - Intergenic
1011942296 6:92857470-92857492 CTTGACTTCTGTGCACCCACAGG + Intergenic
1012179881 6:96139669-96139691 CTTGACTTCTGTGCACCCACAGG + Intronic
1012686227 6:102253382-102253404 CTGGACTCCTGAATACCCAATGG - Intergenic
1013503041 6:110771313-110771335 CTTGACTTCTGTGCACCCACAGG + Intronic
1014469990 6:121801836-121801858 CTTGACTTCTGTGTACCCACAGG - Intergenic
1014563027 6:122913911-122913933 CTTGACTTCTGTGTACCCACAGG - Intergenic
1014721271 6:124920825-124920847 CTTGACTTCTGTGCACCCACAGG + Intergenic
1014883070 6:126746600-126746622 CTTGACTTCTGTGCACCCACAGG + Intergenic
1015351551 6:132225584-132225606 CTTGACTTCTGTGAACCCACAGG - Intergenic
1015776911 6:136823287-136823309 ATGGACGCCTGGAGTCCCACGGG + Intronic
1015852988 6:137593654-137593676 CTTGACTTCTGTGCACCCACAGG + Intergenic
1016020743 6:139234571-139234593 CTTGACTTCTGTGCACCCACAGG - Intergenic
1016166016 6:140944818-140944840 CTTGACTTCTGGGCACCCACAGG - Intergenic
1016176309 6:141081388-141081410 CTTGACTTCTGTGCACCCACAGG - Intergenic
1016202572 6:141430317-141430339 CTTGACTCCTGTGCACCCACAGG + Intergenic
1016253212 6:142071913-142071935 CTTGACTTCTGTGCACCCACAGG - Intronic
1016281782 6:142426794-142426816 CTTGACTTCTGTGCACCCACAGG + Intronic
1016424160 6:143916251-143916273 CTTGACTTCTGTGCACCCACAGG - Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017613135 6:156213246-156213268 ATGGACAACTGGGGACCCAGAGG - Intergenic
1017640668 6:156490780-156490802 CTTGACTTCTGTGCACCCACAGG - Intergenic
1017819157 6:158037330-158037352 CTGGAGTCCTGGAGAGACACAGG - Intronic
1017864336 6:158429876-158429898 ATGGACTCCTGACGACCAACAGG + Exonic
1018041003 6:159922158-159922180 CTTGACTCCTGTGCACTCACAGG - Intergenic
1018364034 6:163100089-163100111 CTGGACTCCTGGGCTGCCCCAGG + Intronic
1018790247 6:167142988-167143010 CTGGACACCTGGGGGCCCAAAGG - Intergenic
1019237069 6:170626693-170626715 CTGGACTTCTGTGAATCCACAGG - Intergenic
1020631847 7:10649490-10649512 CTTGACTTCTGTGCACCCACAGG + Intergenic
1020755054 7:12191223-12191245 CTTGACTTCTGTGCACCCACAGG + Intergenic
1020958790 7:14776612-14776634 CTTGACTTCTGTGTACCCACAGG - Intronic
1021631516 7:22652048-22652070 CTGGAACCTTGGGAACCCACTGG + Intergenic
1022964288 7:35458164-35458186 CTTGACTTCTGTGCACCCACAGG + Intergenic
1023669358 7:42560135-42560157 CTTGACTTCTGTGTACCCACAGG - Intergenic
1025265635 7:57454585-57454607 AGGGAAACCTGGGGACCCACAGG + Intronic
1025719050 7:63992628-63992650 CAGGAAAGCTGGGGACCCACAGG + Intergenic
1025747196 7:64253468-64253490 CAGGAAAGCTGGGGACCCACAGG + Intronic
1025767327 7:64467783-64467805 CTAGAAAGCTGGGGACCCACAGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1025775660 7:64558566-64558588 CTGGAAATCTGGGGACCCACAGG + Intronic
1025778844 7:64581641-64581663 CTGGAAAGCTGGGGACCCACAGG + Intergenic
1025788984 7:64670050-64670072 CTGGACGTCGGGGGACCCACAGG + Intronic
1025802282 7:64797630-64797652 CTGGAAAACTGGAGACCCACAGG + Intronic
1025815439 7:64906704-64906726 CAGGAAAGCTGGGGACCCACAGG + Intronic
1025865540 7:65377404-65377426 CTGGAAAGCTGGGGACCCACAGG + Intronic
1027519092 7:79181345-79181367 CTTGACTTCTGTGCACCCACAGG + Intronic
1027834145 7:83219255-83219277 CTTGACTTCTGAGCACCCACAGG - Intergenic
1028054184 7:86222831-86222853 CTTGACTTCTGTGCACCCACAGG + Intergenic
1028493649 7:91441170-91441192 CTTGACTTCTGTGAACCCACAGG - Intergenic
1028961046 7:96750068-96750090 CTTGACTTCTGTGAACCCACAGG + Intergenic
1029948312 7:104556383-104556405 CTTGACTTCTGTGCACCCACAGG + Intronic
1030807163 7:113932353-113932375 ATTGACTTCTGTGGACCCACAGG + Intronic
1031522086 7:122778724-122778746 CTTGACTTCTGTGCACCCACAGG - Intronic
1031608238 7:123794647-123794669 CTTGACTTCTGCGCACCCACAGG - Intergenic
1031783300 7:125997536-125997558 CTTGACTTCTGTGCACCCACAGG - Intergenic
1031791979 7:126118122-126118144 CTTGACTTCTGTGCACCCACAGG - Intergenic
1033419481 7:141193488-141193510 CTGGATGCCTGGGGTCCCAGGGG + Intronic
1033492021 7:141853448-141853470 CTTGACTTCTGTGCACCCACAGG + Intergenic
1033721092 7:144060231-144060253 CTTGACTTCTGTGCACCCACAGG - Intergenic
1034139401 7:148802170-148802192 CTCCTCTCCTGGGGACACACTGG - Intergenic
1034497634 7:151431944-151431966 CCGGACTCCCAGGGACCCCCTGG - Intronic
1034510705 7:151532295-151532317 CTTGACTTCTGGGCACCCACAGG + Intergenic
1034751054 7:153569353-153569375 CTTGACTTCTGTGAACCCACAGG + Intergenic
1034851904 7:154501594-154501616 CTTGACTTCTGTGCACCCACAGG - Intronic
1036686467 8:10914803-10914825 CTGGCCTCCTGGGTAGCCCCTGG + Intronic
1038298963 8:26324447-26324469 CTTGACTTCTGTGCACCCACAGG - Intronic
1038661111 8:29497794-29497816 CAGGGCTGCTGGGGACTCACAGG - Intergenic
1039076001 8:33690781-33690803 CTGGGCTCCTGGGGACACTGAGG - Intergenic
1039082332 8:33745373-33745395 CTTGACTTCTGTGCACCCACAGG + Intergenic
1040813408 8:51481794-51481816 CTTGACTTCTGTGTACCCACAGG - Intronic
1041738902 8:61138650-61138672 CTGGACTCCTGGGGACCCACTGG - Intronic
1041927554 8:63252216-63252238 CTTGACTTCTGTGAACCCACAGG - Intergenic
1042057989 8:64786886-64786908 CTTGACTTCTGTGCACCCACAGG + Intronic
1042073934 8:64967661-64967683 CTTGACTTCTGTGCACCCACAGG + Intergenic
1042772954 8:72398916-72398938 CTTGACTTCTGTGTACCCACAGG + Intergenic
1043510510 8:80946065-80946087 CTTGACTTCTGTGTACCCACAGG - Intergenic
1043749875 8:83921966-83921988 CTTGACTTCTGTGCACCCACAGG + Intergenic
1044066572 8:87706304-87706326 CTTGACTTCTGAGTACCCACAGG + Intergenic
1044279722 8:90341021-90341043 CTTGACTTCTGTGCACCCACAGG - Intergenic
1044755700 8:95458891-95458913 CTAGACCCCTGGGGACCCTGGGG + Intergenic
1045214173 8:100130224-100130246 CTTGACTTCTGTGCACCCACAGG + Intronic
1045317749 8:101058038-101058060 CAGGGCTCCTGTGGACCCCCTGG + Intergenic
1045940075 8:107728540-107728562 CTTGACTTCTGTGCACCCACAGG + Intergenic
1046129267 8:109946708-109946730 CTTGACTTCCGTGGACCCACAGG - Intergenic
1046231523 8:111364546-111364568 CTTGACTTCTGTGAACCCACAGG + Intergenic
1046309447 8:112415359-112415381 CTTGACTTCTGTGCACCCACAGG - Intronic
1047115954 8:121842259-121842281 CTTGACTTCTGTGCACCCACAGG - Intergenic
1047586907 8:126282858-126282880 CTTGACTCCTGTGCACCCACAGG - Intergenic
1047795361 8:128249697-128249719 CTTGACTCCTGTTGACCCTCTGG - Intergenic
1047869946 8:129071506-129071528 CTTGACTTCTGTGTACCCACAGG - Intergenic
1048189259 8:132273271-132273293 CTTGACTTCTGTGCACCCACAGG + Intronic
1048574677 8:135681286-135681308 CTGGAATTCAGGGGACTCACTGG - Intergenic
1048669083 8:136696056-136696078 CTTGACTTCTGTGCACCCACAGG - Intergenic
1048772779 8:137912996-137913018 CTTGACTTCTGTGCACCCACAGG + Intergenic
1048867265 8:138770181-138770203 CAGGACACCTGGGGAACCTCAGG + Intronic
1049279611 8:141737588-141737610 CTGAACTCCGTGGGACCAACAGG - Intergenic
1049448945 8:142648552-142648574 CTTGACTTCTGTGGACTCACAGG - Intergenic
1049449123 8:142649651-142649673 CTGGACTTCTGTGCACTCACAGG - Intergenic
1049612858 8:143563460-143563482 CTGCCCTCCTGGGGCCACACAGG + Intergenic
1049859747 8:144890353-144890375 CTGGTCTCCTGGGGACTCCGAGG + Exonic
1049903156 9:189514-189536 CTTGACTTCTGTGCACCCACAGG + Intergenic
1050079796 9:1904313-1904335 CTTGACTTCTGTGTACCCACAGG - Intergenic
1050412506 9:5381462-5381484 CTTGACTTCTGTGCACCCACAGG - Intronic
1050512963 9:6413691-6413713 CTGGGCTCCTCTGGACGCACCGG + Intronic
1050938203 9:11425049-11425071 GTTGACTCCTGTGCACCCACAGG + Intergenic
1051128714 9:13835200-13835222 CTTGACTTCTGTGCACCCACAGG - Intergenic
1051902669 9:22059816-22059838 CTTGACTTCTGGGCACCCACAGG + Intergenic
1051984251 9:23063696-23063718 CTTGACTTCTGTGCACCCACAGG + Intergenic
1052070972 9:24081047-24081069 CTTGACTTCTGTGCACCCACAGG - Intergenic
1052105543 9:24510300-24510322 CTTGACTTCTGTGCACCCACAGG - Intergenic
1052187785 9:25620105-25620127 CTTGACTTCTGGGCACCCACAGG + Intergenic
1052351772 9:27465724-27465746 CTTGACTTCTGTGCACCCACAGG + Intronic
1052498336 9:29257298-29257320 CTTCACTCCTGATGACCCACAGG - Intergenic
1052518191 9:29510306-29510328 CTTGACTTCTGTGCACCCACAGG + Intergenic
1052557136 9:30032149-30032171 CTTGACTTCTGTGCACCCACAGG + Intergenic
1052599065 9:30600468-30600490 CTTGACTTCTGTGTACCCACAGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052705407 9:31988625-31988647 CTTGACTACTGTGCACCCACAGG + Intergenic
1053371337 9:37564197-37564219 CTTGACTTCTGTGCACCCACAGG - Intronic
1053571945 9:39318813-39318835 CTTGACTTCTGTGAACCCACAGG - Intergenic
1053574507 9:39345105-39345127 CTTGACTTCTGTGCACCCACAGG - Intergenic
1053882660 9:42611533-42611555 CTTGACTTCTGTGAACCCACAGG + Intergenic
1053890009 9:42682769-42682791 CTTGACTTCTGTGAACCCACAGG - Intergenic
1054093499 9:60877524-60877546 CTTGACTTCTGTGAACCCACAGG - Intergenic
1054096071 9:60903795-60903817 CTTGACTTCTGTGCACCCACAGG - Intergenic
1054114982 9:61153444-61153466 CTTGACTTCTGTGAACCCACAGG - Intergenic
1054117534 9:61179734-61179756 CTTGACTTCTGTGCACCCACAGG - Intergenic
1054125200 9:61300198-61300220 CTTGACTTCTGTGAACCCACAGG + Intergenic
1054221687 9:62419001-62419023 CTTGACTTCTGTGAACCCACAGG + Intergenic
1054229027 9:62490172-62490194 CTTGACTTCTGTGAACCCACAGG - Intergenic
1054344993 9:63905689-63905711 CTTGACTTCTGTGCACCCACAGG - Intergenic
1054590221 9:67002832-67002854 CTTGACTTCTGTGCACCCACAGG + Intergenic
1054592774 9:67029090-67029112 CTTGACTTCTGTGAACCCACAGG + Intergenic
1055713335 9:79089058-79089080 CTTGACTTCTGTGCACCCACAGG + Intergenic
1055843290 9:80531523-80531545 CTTGACTACTGGGCAACCACAGG + Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056042844 9:82685864-82685886 CTTGACTTCTGTGCACCCACAGG + Intergenic
1056064184 9:82916268-82916290 CTCGACTTCTGTGCACCCACAGG + Intergenic
1056283934 9:85069425-85069447 CTTGACTTCTGTGCACCCACAGG - Intergenic
1056639390 9:88357667-88357689 CTTGACTTCTGTGCACCCACAGG - Intergenic
1056742988 9:89276054-89276076 CTTGACTTCTGTGCACCCACAGG + Intergenic
1056915065 9:90739122-90739144 CTTGACTTCTGTGTACCCACAGG + Intergenic
1058292228 9:103256935-103256957 CTTGACTTCTGTGCACCCACAGG + Intergenic
1058834457 9:108848761-108848783 CTTGACTTCTGTGCACCCACAGG + Intergenic
1059069501 9:111120519-111120541 CTTGACTTCTGTGCACCCACAGG + Intergenic
1059587253 9:115619709-115619731 CTTGACTTCTGTGCACCCACAGG + Intergenic
1059601415 9:115783313-115783335 CTTGACTTCTGTGTACCCACAGG - Intergenic
1060016905 9:120094658-120094680 CTGGAACCCAGGGGACACACAGG + Intergenic
1060053212 9:120391647-120391669 CAGGACTCTTAGGGTCCCACTGG + Intronic
1060178365 9:121514330-121514352 CTTGACTTCTGTGCACCCACAGG + Intergenic
1060311941 9:122470370-122470392 CTTGACTTCTGTGCACCCACAGG - Intergenic
1060653626 9:125352395-125352417 CTTGACTTCTGTGCACCCACAGG + Intronic
1061038628 9:128127368-128127390 CGGGACTCCTGGGAACCCGCAGG - Intronic
1061290635 9:129648815-129648837 CTGGATTCCTGGGTTCCCAGAGG + Intergenic
1061671683 9:132192270-132192292 GGGGAATTCTGGGGACCCACCGG - Intronic
1061719417 9:132542582-132542604 ATGGAGTCCTGGGGACCCACTGG + Intronic
1061799342 9:133105553-133105575 CTGGCCTCCCGGGGACAGACTGG + Intronic
1062311001 9:135937160-135937182 CTCAGCTCCTGGGGACCAACAGG + Intronic
1062329578 9:136032071-136032093 CCAGACTCCTGGGATCCCACCGG + Intronic
1062402068 9:136377121-136377143 CTGGATTTCTGGGGTCCCAAAGG - Intronic
1062440254 9:136566511-136566533 CTGTGCTCCTTGGGACCCGCTGG - Intergenic
1062552464 9:137095900-137095922 CGGGAGGCCTGGGGACCCAGAGG + Intronic
1062585241 9:137246288-137246310 CTGGCCTCCTGGGGTGGCACAGG - Intronic
1203564275 Un_KI270744v1:79126-79148 CAGGACTCTTGGGGACCTCCCGG - Intergenic
1185459427 X:328048-328070 CTGCACCCCAGGGGTCCCACAGG + Intergenic
1186053314 X:5623653-5623675 CTTGACTTCTGTGCACCCACAGG - Intergenic
1186620441 X:11235205-11235227 CTTGACTTCTGTGTACCCACGGG + Intronic
1187574758 X:20542464-20542486 CTTGACTTCTGTGTACCCACAGG - Intergenic
1187667397 X:21628557-21628579 CTTGACTTCTGTGCACCCACAGG + Intronic
1187796200 X:23006658-23006680 CTTGACTTCTGTGCACCCACAGG + Intergenic
1188056045 X:25542108-25542130 CTTGACTTCTGTGCACCCACAGG + Intergenic
1188158915 X:26776422-26776444 CTTGACTTCTGTGCACCCACAGG - Intergenic
1188624329 X:32265319-32265341 CTTGACTTCTGTGTACCCACAGG - Intronic
1188719490 X:33505588-33505610 CTTGACTTCTGTGCACCCACAGG - Intergenic
1188899444 X:35711715-35711737 CTGGATTCTTGGGCCCCCACAGG - Intergenic
1188997603 X:36904906-36904928 CTTGACTTCTGTGCACCCACAGG - Intergenic
1189788710 X:44583323-44583345 CTTGACTTCTGTGGACCCACAGG - Intergenic
1189896152 X:45658739-45658761 CTTGACTTCTGTGCACCCACAGG - Intergenic
1189945316 X:46171550-46171572 CTTGACTTCTGAGCACCCACAGG + Intergenic
1190283759 X:48948616-48948638 CTGGACTGCTAGCCACCCACTGG + Intronic
1190393296 X:49954263-49954285 CTGGACTGCACGTGACCCACAGG - Intronic
1192131891 X:68559409-68559431 CTTGACTTCTGTGTACCCACAGG + Intergenic
1192335620 X:70216966-70216988 CTTGACTTCTGTGTACCCACAGG - Intergenic
1192378306 X:70587508-70587530 CTTGACTTCTGTGCACCCACAGG - Intronic
1192742433 X:73906116-73906138 CTTGACTTCTGTGCACCCACAGG - Intergenic
1192846285 X:74909906-74909928 CTTGACACCTGTGCACCCACAGG - Intronic
1193320398 X:80114880-80114902 CTTGACTTCTGTGCACCCACAGG - Intergenic
1193459730 X:81775912-81775934 CTTGACTTCTGTGCACCCACAGG + Intergenic
1193686228 X:84580154-84580176 CTTGACTTCTGTGCACCCACAGG - Intergenic
1193759179 X:85443267-85443289 CTTGACTTCTGTGCACCCACAGG + Intergenic
1193857850 X:86626668-86626690 CTTGACTTCTGGGCACCCAGAGG + Intronic
1194082556 X:89486704-89486726 CTTGACTCCTGTGTACCCACAGG + Intergenic
1194256915 X:91646144-91646166 CTTGACTTCTGTGCACCCACAGG - Intergenic
1194332474 X:92600494-92600516 CTTGACTTCTGTGCACCCACAGG - Intronic
1194503815 X:94708597-94708619 CTTGACTTCTGTGCACCCACAGG + Intergenic
1194505608 X:94730088-94730110 CTTGACTTCTGTGCACCCACAGG + Intergenic
1194522486 X:94935910-94935932 CTGGACTTCTGCACACCCACAGG - Intergenic
1194582821 X:95697534-95697556 CTTGACTTCTGTGCACCCACAGG - Intergenic
1194756305 X:97743340-97743362 CTTGACTTCTGTGCACCCACAGG - Intergenic
1194843613 X:98776068-98776090 CTTGACTTCTGTGCACCCACAGG - Intergenic
1194985468 X:100485305-100485327 CTGGACAAATGGGGATCCACTGG - Intergenic
1195206936 X:102610801-102610823 CTTGACTTCTGTGCACCCACAGG - Intergenic
1196012628 X:110904792-110904814 CTTGACTTCTGTGCACCCACAGG + Intergenic
1196169784 X:112574821-112574843 CTTGACTTCTGTGCACCCACAGG - Intergenic
1196565210 X:117196861-117196883 CTTGACTACTGTGTACCCACAGG - Intergenic
1196828258 X:119757942-119757964 CTGGAATCCTGGGCAGCCCCGGG + Intergenic
1197054277 X:122097950-122097972 CTTGACTTCTGTGTACCCACGGG - Intergenic
1197349791 X:125369919-125369941 CTTGACTTCTGTGCACCCACAGG + Intergenic
1197431883 X:126376818-126376840 CTTGACTTCTGTGCACCCACAGG + Intergenic
1197527031 X:127576337-127576359 CTTGACTTCTGTGCACCCACAGG + Intergenic
1197639754 X:128954709-128954731 CTTGACTTCTGTGCACCCACAGG + Intergenic
1198497159 X:137204235-137204257 CTTGACTTCTGTGCACCCACAGG + Intergenic
1198566065 X:137906738-137906760 CTTGACTTCTGTGCACCCACAGG - Intergenic
1198749372 X:139923256-139923278 CTGGGCCTCTGGGGACCCAAAGG - Intronic
1198919365 X:141708356-141708378 CTTGACTTCTGTGCACCCACAGG + Intergenic
1198932794 X:141879074-141879096 CTGGACTCCTGGAAACCGCCTGG - Intronic
1198941981 X:141966058-141966080 CTTGACTTCTGTGTACCCACAGG - Intergenic
1199027893 X:142961224-142961246 CTTAACTCCTGGGCACCCACAGG + Intergenic
1199042230 X:143127346-143127368 CTTGACTTCTGTGCACCCACAGG - Intergenic
1199043224 X:143139102-143139124 CTTGACTTCTGTGCACCCACTGG - Intergenic
1199155029 X:144536881-144536903 CTTGACTTCTGTGCACCCACAGG + Intergenic
1199228674 X:145409608-145409630 CTTGACTTCTGTGCACCCACAGG - Intergenic
1199291114 X:146105897-146105919 CTTGACTTCTGTGTACCCACAGG + Intergenic
1199349826 X:146787659-146787681 CTTGACTTCTGTGCACCCACAGG - Intergenic
1199389411 X:147262192-147262214 CTTGACTTCTGTGAACCCACAGG - Intergenic
1199420345 X:147637164-147637186 CTTGACTTCTGTGCACCCACAGG - Intergenic
1199869785 X:151888105-151888127 CTTGACTTCTGTGCACCCACAGG - Intergenic
1200435204 Y:3142585-3142607 CTTGACTCCTGTGTACCCACAGG + Intergenic
1200575634 Y:4885411-4885433 CTTGACTTCTGTGCACCCACAGG - Intergenic
1200641175 Y:5719546-5719568 CTTGACTTCTGTGCACCCACAGG - Intronic
1201452250 Y:14129173-14129195 CTTGACTTCTGTGCACCCACAGG - Intergenic