ID: 1041742860

View in Genome Browser
Species Human (GRCh38)
Location 8:61175743-61175765
Sequence ATGTTCCCTCTTAGGGTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041742860 Original CRISPR ATGTTCCCTCTTAGGGTCTA GGG (reversed) Intronic
902268838 1:15288694-15288716 ATGTCCCCTCTAAGGGATTAGGG - Intronic
903755596 1:25658338-25658360 ATGCTAGCCCTTAGGGTCTATGG - Intronic
904109373 1:28113472-28113494 ATCTACCCTCTTAGGTTCTATGG + Intergenic
904465394 1:30704577-30704599 ATCTTCCCTCACAGGGCCTATGG - Intergenic
906244582 1:44263902-44263924 ATGTCCCCTACTGGGGTCTAGGG - Intronic
912263115 1:108128876-108128898 ATGTTCCCCCTTAAGATATAGGG - Intergenic
914699694 1:150120524-150120546 ATATTTCCTATTAGGATCTAAGG - Intronic
916526467 1:165614499-165614521 ATGTTCCCTATTTGGGTCATGGG + Intergenic
921245265 1:213232109-213232131 TTGTTCTCTGTCAGGGTCTAAGG + Exonic
924690534 1:246345800-246345822 ATATTGCCTCTTAGGGTGTTAGG - Intronic
1068167013 10:53343256-53343278 ATGTTACCTCTTAGAATGTACGG - Intergenic
1070458075 10:76637695-76637717 ATTTTCCCTCTTTGGGTTTTAGG - Intergenic
1071195826 10:83158109-83158131 ATGTGCCCTCTTAAGGTATTTGG + Intergenic
1072184816 10:93026823-93026845 TTGTTACCTCTTAGGGAATAGGG - Intronic
1073641056 10:105252945-105252967 TTGTGCCCTCTCAGGGTGTAGGG - Intronic
1074275648 10:111999417-111999439 ATGTTGCCTCCTAGGGTGCATGG + Intergenic
1076783758 10:132738950-132738972 AGGGTCCCCCTTCGGGTCTAGGG + Intronic
1078197259 11:9146299-9146321 ATCTTCCCTTTTAGAGACTAGGG - Intronic
1078560014 11:12363334-12363356 ATGTTTCCTCTTAGGGAGGAAGG - Intergenic
1078560200 11:12364535-12364557 ATGTTCCCTCTGAGACTCTAGGG + Intergenic
1079302367 11:19289574-19289596 ATGTCCTCTCTTAGGGTCAGTGG - Intergenic
1083862188 11:65427197-65427219 GTGTTACCTCTTGGGGTGTAAGG + Intergenic
1086722887 11:90143909-90143931 AGGTTCCATGTTAGTGTCTATGG + Intronic
1088951185 11:114571796-114571818 CTGTTCCTTCAAAGGGTCTATGG - Intronic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1092727958 12:11502481-11502503 ATGTTTCCTCTTAGATTCTATGG - Intergenic
1092924887 12:13263700-13263722 TTTTGACCTCTTAGGGTCTAGGG + Intergenic
1098687641 12:73444838-73444860 ATGTTACTTCATAGGGTCAAGGG + Intergenic
1100747801 12:97664766-97664788 TTGTTCCCTCTTTGTGTCCATGG + Intergenic
1101331281 12:103759762-103759784 TTCTACCCTCTTAGGGTCTGTGG + Intronic
1101478474 12:105074094-105074116 ATGTTCACTCTTTGGGTATCAGG + Intronic
1103045805 12:117733614-117733636 ATTTTCCCTGTAAGGGTCCAGGG - Intronic
1103166924 12:118778300-118778322 ATGTTCCCTCAGAGGCTCTAGGG - Intergenic
1104406366 12:128520506-128520528 ATCTTCCATCTCTGGGTCTAAGG - Intronic
1110294346 13:73845151-73845173 ATATTCCCTTTTAGGGTAGAAGG - Intronic
1110329481 13:74254926-74254948 CTGTTCCCTCTTGAGCTCTATGG - Intergenic
1118513107 14:66498095-66498117 ATGTTTCCCCTTAGGTACTATGG + Intergenic
1124940805 15:34215980-34216002 ATGCGCCCTCTGAAGGTCTAGGG + Intergenic
1125870604 15:43098119-43098141 TTGTCCCATCTTAGGGTATAGGG + Intronic
1134101403 16:11454614-11454636 ATGTTCTCTCTAAGGCTCTGGGG - Intronic
1134342216 16:13356295-13356317 CTTTTGCCTTTTAGGGTCTAGGG + Intergenic
1137513663 16:49123967-49123989 ATTTTACCTCTTAGGGTCGGTGG + Intergenic
1139019150 16:62725728-62725750 CTGTTCACTCTTTGGGTCTGTGG + Intergenic
1141478211 16:84288141-84288163 GTGCTCCCTCTGAGGCTCTAGGG + Intergenic
1145771406 17:27495892-27495914 CTGTTCCCTCTGAGAGCCTAGGG - Intronic
1148398077 17:47325992-47326014 AGGTTCTCTCCTAGGCTCTAGGG - Intronic
1151447964 17:74179522-74179544 GTGCTCCCTCTGAGGCTCTAGGG - Intergenic
1151514022 17:74580601-74580623 ATGTTCCCTGTTACTTTCTATGG + Intronic
1151622450 17:75254531-75254553 CTTTGACCTCTTAGGGTCTAGGG - Intronic
1152550313 17:81026531-81026553 ACTTCCCCTGTTAGGGTCTAAGG + Intergenic
1153704221 18:7728621-7728643 ATGTTCTCCCTTTGGGTCTTGGG + Intronic
1156240045 18:35244572-35244594 CTGTTCCTTCTTAGATTCTAGGG - Intronic
1161369506 19:3902656-3902678 ATGTTCTGTCCTGGGGTCTATGG + Intronic
925226926 2:2191257-2191279 AGGATCCCTCTTAGGGCCAATGG + Intronic
928443992 2:31316957-31316979 ATGTTTCCTATTAAGATCTAAGG + Intergenic
931640947 2:64380550-64380572 GTGTTCCCTCTCAGGGTTCATGG + Intergenic
932847127 2:75147301-75147323 ATGTTCCCACTGAGGTTCTGGGG - Intronic
933409404 2:81906322-81906344 AAGTTCCCTCTTATGGTGTAGGG - Intergenic
935648396 2:105361065-105361087 ATCTTCCCACCTAGGGCCTAGGG + Exonic
935669508 2:105543197-105543219 ATCTACCCTCTTAGGGTCCCTGG - Intergenic
936245361 2:110821491-110821513 ATGGTCCCTCTTAGCTTCAAAGG - Intronic
938589066 2:132719912-132719934 ATGTTTCCTCTTGGGGTGTCTGG + Intronic
938985695 2:136573223-136573245 ATGCTCCCTCTGAAGGTATAGGG - Intergenic
938990104 2:136619172-136619194 TTCTTCCCTCTCAAGGTCTATGG + Intergenic
943604869 2:189965130-189965152 TTGTTGCATCTTAGGGTATAGGG + Intronic
945580423 2:211587548-211587570 ATGCTCCCTCTAAGTCTCTAGGG - Intronic
948182186 2:235990703-235990725 AGAGTCCCACTTAGGGTCTAGGG + Intronic
1171007363 20:21479673-21479695 ATCTTTCCTCTTTGTGTCTAGGG + Intergenic
1171852512 20:30318577-30318599 GTGTCCCCTCTTAGTATCTATGG + Intergenic
1174127066 20:48314416-48314438 CTGTTCCATCTTAGGGTCCTAGG - Intergenic
1174505381 20:51014453-51014475 ATTTTGCCTCTGAGGGTCTGTGG + Intronic
1174834417 20:53842780-53842802 TTGTTGTGTCTTAGGGTCTAGGG - Intergenic
1175294475 20:57898928-57898950 GTGTTCCTTCTGAGGCTCTAAGG + Intergenic
1178473372 21:32915154-32915176 ATGTGCCCTCTTAGAGTCTCTGG - Intergenic
1183907061 22:41049541-41049563 TTGTTCCCTCTTGGGGTCAAGGG + Intergenic
1184683449 22:46085313-46085335 ATGTTCCCTATTAGGAAATAAGG - Intronic
949485884 3:4537505-4537527 ATGTTACCTCATATGGTATAGGG + Intronic
949948181 3:9206938-9206960 AGGTGCCATTTTAGGGTCTAGGG - Intronic
952319290 3:32260832-32260854 AGTTTCCCTCTTAGGAACTAGGG - Intronic
953479932 3:43242761-43242783 ATGTGCCCTCTTAGGGGACAAGG + Intergenic
955160035 3:56456090-56456112 ATGTACCCTCCTAAGGTTTATGG + Intronic
956250110 3:67226762-67226784 ATCTTCCCAGTTAAGGTCTATGG + Intergenic
958148768 3:89661843-89661865 AAGTTTCCTCTTAGAGTTTATGG + Intergenic
959274357 3:104258971-104258993 ATTTTCCCTCTTTGGGTCTGTGG + Intergenic
960282915 3:115797230-115797252 CTTTTGCCTTTTAGGGTCTAGGG + Intergenic
963571175 3:146998407-146998429 AGGTTGCCTCGTAGGGTCTGTGG + Intergenic
966967434 3:185008761-185008783 ATTTTCCCTTTTAGGCACTATGG - Intronic
968124858 3:196151523-196151545 ATGCTCCTTCTGAGGCTCTAGGG + Intergenic
969087173 4:4665171-4665193 ATGTTCCCTCTGAAGCTCTTGGG + Intergenic
971722479 4:30264105-30264127 AGATTCCCTCTTAGTGTCTCTGG - Intergenic
972126736 4:35777190-35777212 ATGTTTCCTCATTGGTTCTAAGG + Intergenic
972621360 4:40750506-40750528 ATGCTCCCTCTTAGTCTTTAAGG + Intronic
976951464 4:90836735-90836757 ATGTTACCTCTGAGGTTCTGAGG - Intronic
979384968 4:120054173-120054195 TTGTTTCCTCTCAGAGTCTAGGG - Intergenic
979493451 4:121357308-121357330 ATGCTCTCTCTTAGGATCTCAGG - Intronic
984226722 4:177044198-177044220 ATGTTGCATGTCAGGGTCTACGG + Intergenic
984338753 4:178426626-178426648 CTTTTCCCTCTTAGGTTCTCAGG + Intergenic
984342439 4:178474204-178474226 AATTTTCCTCTTAGGTTCTAAGG + Intergenic
984931931 4:184855619-184855641 ATGCTGTCTCTTAGGGACTAAGG - Intergenic
985241170 4:187932295-187932317 ATGTTCCCTCTGAGGATCCTGGG - Intergenic
994147532 5:96411778-96411800 ATTTTCCCTATTTGGGTCTGAGG - Intronic
995139605 5:108720656-108720678 ATGTGCCATCTAAGGCTCTAAGG + Intergenic
1001085650 5:168698515-168698537 ATGCTCCCTCTGAGCCTCTAGGG - Intronic
1001280809 5:170385167-170385189 ATGCTCATTCTTAGGTTCTAGGG - Intronic
1001317266 5:170652688-170652710 ATGTTCCATGTCAGGCTCTAGGG + Intronic
1003939203 6:11007521-11007543 TTGTTCCCTCTGAGGTTCTAGGG - Intronic
1004210415 6:13635890-13635912 ATGATCCCTGTTAGGTGCTAAGG + Intronic
1006891973 6:37436535-37436557 ATGTTCCCTCAAAGGCTCTTGGG + Intronic
1007908346 6:45487335-45487357 ATGTCCCCTCTCAGGGACTCAGG + Intronic
1008178812 6:48302219-48302241 CTATTCCCTTTTAGGGTCTCAGG - Intergenic
1008973811 6:57401507-57401529 ATGTTCCCTCTTAATGTGTGGGG + Intronic
1009845114 6:69125086-69125108 AGGCTTCCTCTTAGGGTCCACGG + Intronic
1010390276 6:75329076-75329098 ATCTTTCTTCTTATGGTCTAAGG + Intronic
1012962766 6:105639871-105639893 CTGTTCCATCTTAGGATCTCAGG - Intergenic
1015288075 6:131508011-131508033 TTTTGCCCTTTTAGGGTCTAGGG + Intergenic
1016383024 6:143504509-143504531 ATTTTCCCTCTTAGATTTTAAGG + Intronic
1016825442 6:148384288-148384310 ATTTTCCCTCTTTGGTTCTCTGG - Intronic
1018197210 6:161365914-161365936 ATTTTCCCTCTTCCAGTCTAAGG - Intronic
1021126848 7:16860740-16860762 ATGTTCACTATTAGGGTGTTGGG - Intronic
1021617659 7:22519746-22519768 ATTTTCCCTCTTAGGCTTTTGGG - Intronic
1022760097 7:33339591-33339613 ATGTTTCCTCTCAGGGTCACAGG + Intronic
1022927252 7:35069236-35069258 ATTTTCCCTCTTAGGCTTTTGGG - Intergenic
1023895487 7:44429480-44429502 ATGTTCCCTCTGAAGGTCTTAGG - Intronic
1025563336 7:62399258-62399280 ATGTACTCTCTTAGGGCATATGG + Intergenic
1026140763 7:67704319-67704341 ATGTTCCCTGTTACGGGCCATGG + Intergenic
1026824690 7:73574106-73574128 ATGTTCCCGCTGTGGCTCTAGGG + Exonic
1027589942 7:80105878-80105900 ATGTTTCCTCTGAGGCTCTAGGG - Intergenic
1027713619 7:81641056-81641078 CTTTACCCTCTTAGGCTCTATGG + Intergenic
1034418319 7:150976656-150976678 CTCTTCCCTCTTTGGGTCTCAGG - Intronic
1034746479 7:153528113-153528135 ACGTTCTCTCTTACAGTCTAAGG + Intergenic
1036639452 8:10573227-10573249 TTTTGACCTCTTAGGGTCTAGGG - Intergenic
1041574691 8:59380744-59380766 CTCTACCCTCTTAGGGTCTCTGG + Intergenic
1041742860 8:61175743-61175765 ATGTTCCCTCTTAGGGTCTAGGG - Intronic
1044095531 8:88059495-88059517 ATTTTCCCTCTTTGGGTAGATGG + Intronic
1045396834 8:101769120-101769142 CCTTTCCCTCTGAGGGTCTAGGG - Intronic
1045800554 8:106096471-106096493 ATGCTCCCTCTTTGGGTACAGGG - Intergenic
1045996452 8:108367392-108367414 AGGATCCCTATTAGGTTCTAAGG - Intronic
1046059636 8:109122108-109122130 AAATTCCCTCTTAGGACCTAAGG + Intergenic
1053067029 9:35076056-35076078 AGGTTCCCTGCTAGGGCCTAGGG - Intronic
1054154840 9:61632880-61632902 GTGTCCCCTCTTAGTGTCTATGG - Intergenic
1056769855 9:89469122-89469144 ATGTTCCTTTTTAATGTCTATGG - Intronic
1058176277 9:101738847-101738869 ATTTTCCTTCTTAGGTTTTAGGG - Intergenic
1058508045 9:105686795-105686817 ATTTTCCCTCTCTGTGTCTACGG + Intergenic
1058628707 9:106962992-106963014 ATGTTCCCCCTTAGACACTATGG + Intronic
1059517911 9:114913067-114913089 ACTTTCCCTCTCAGGGTCTTGGG - Intronic
1186872446 X:13785905-13785927 ATCTCCCCTCTCAGGCTCTATGG + Intronic
1188671641 X:32888544-32888566 ATGTTCCCATTAAGGGTCCAAGG - Intronic
1190801787 X:53795863-53795885 ATTTTCCCTCATCTGGTCTAAGG - Intergenic
1195024248 X:100860132-100860154 CTGGTCCCTATTAGTGTCTATGG + Intronic
1199228914 X:145411969-145411991 GTGTTCTTTCTTAGGGTCTAGGG + Intergenic
1202141958 Y:21734063-21734085 CTGTTCCCGTTTAGTGTCTAGGG - Intergenic
1202144907 Y:21769739-21769761 CTGTTCCCGTTTAGTGTCTAGGG + Intergenic