ID: 1041747694

View in Genome Browser
Species Human (GRCh38)
Location 8:61226735-61226757
Sequence CTGAGGCTGGGGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041747687_1041747694 -7 Left 1041747687 8:61226719-61226741 CCTCAGCTTCTTAACACTGAGGC 0: 1
1: 0
2: 2
3: 13
4: 153
Right 1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041747694 Original CRISPR CTGAGGCTGGGGAGGGAAGA GGG Intronic
No off target data available for this crispr