ID: 1041748779

View in Genome Browser
Species Human (GRCh38)
Location 8:61236893-61236915
Sequence GCAGTCAGAGGTGCAGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 255}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041748779_1041748782 -8 Left 1041748779 8:61236893-61236915 CCAACATCTGCACCTCTGACTGC 0: 1
1: 0
2: 0
3: 30
4: 255
Right 1041748782 8:61236908-61236930 CTGACTGCCTACAATGCTGGTGG No data
1041748779_1041748785 21 Left 1041748779 8:61236893-61236915 CCAACATCTGCACCTCTGACTGC 0: 1
1: 0
2: 0
3: 30
4: 255
Right 1041748785 8:61236937-61236959 GAATAGAGTGCAATTCATTAAGG No data
1041748779_1041748783 -4 Left 1041748779 8:61236893-61236915 CCAACATCTGCACCTCTGACTGC 0: 1
1: 0
2: 0
3: 30
4: 255
Right 1041748783 8:61236912-61236934 CTGCCTACAATGCTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041748779 Original CRISPR GCAGTCAGAGGTGCAGATGT TGG (reversed) Intronic
900715072 1:4138933-4138955 GGAGTCAGATATGCAGGTGTTGG - Intergenic
901740626 1:11339503-11339525 GGAGTCAGACGTGCAGCTGCAGG + Intergenic
902053236 1:13580584-13580606 GCTGTCAGAGATTCAGTTGTGGG + Intergenic
902625808 1:17675653-17675675 GCAGGCATGGGTGCAGGTGTGGG + Intronic
902625873 1:17676052-17676074 GCAGGCATGGGTGCAGGTGTAGG + Intronic
902625903 1:17676196-17676218 GCAGGCATAGGTGCAGGTGTGGG + Intronic
902625944 1:17676422-17676444 GCAGGCATGGGTGCAGGTGTGGG + Intronic
903819933 1:26094361-26094383 GCATTCCGAGGTGGAGAGGTGGG - Intergenic
903833663 1:26189427-26189449 GGAGTCAGAGGTCAAGATGTGGG - Exonic
904311689 1:29633200-29633222 GCTGTCAGAGCTCCAGCTGTGGG - Intergenic
906911164 1:49952583-49952605 GGAGTCAGAGGTGCTGAATTTGG - Intronic
908007596 1:59742650-59742672 TCAGGCAGAGGTGGAGATGGTGG - Intronic
912078387 1:105907266-105907288 GCAGGCAGTGGTGAAGCTGTGGG + Intergenic
912212555 1:107570900-107570922 GCCGCCGCAGGTGCAGATGTTGG - Intergenic
914804885 1:150984514-150984536 GCAGACAGAGGGGCAGACGCTGG - Intronic
915615091 1:157031533-157031555 TGAGTCTGAGATGCAGATGTGGG - Intronic
916077748 1:161212298-161212320 ACAGTCAGAGGAGCAGGTATGGG - Intronic
917491874 1:175505002-175505024 GGAGTCTGAGGTCCAGGTGTCGG - Intronic
918451805 1:184665737-184665759 GCAGTCAGAGATCTTGATGTCGG + Intergenic
919352234 1:196472056-196472078 CCAGCCAGAGGGACAGATGTGGG - Intronic
921667611 1:217891496-217891518 GCAGGTAGAGGTGCAGGGGTGGG + Intergenic
922375345 1:224958373-224958395 GCACTAGGATGTGCAGATGTAGG + Intronic
924453328 1:244198664-244198686 GGAGTCAGAGGGGAAGAGGTGGG + Intergenic
1062769206 10:86159-86181 GCAGACACAGGTGCAGATGCAGG + Intergenic
1063261794 10:4397382-4397404 ACAGTTAGAGGTGCTCATGTAGG - Intergenic
1063870987 10:10417528-10417550 GCAATCAGAGGTGCAAATCTGGG - Intergenic
1065454354 10:25891669-25891691 GCAGGCAGACGGGCAGATGCAGG + Intergenic
1065719110 10:28608260-28608282 GATGTTGGAGGTGCAGATGTGGG - Exonic
1068249141 10:54413393-54413415 GTTGTCAGAGGTGGAGATGCAGG - Intronic
1069660513 10:70120641-70120663 GCAGACAGAGGTGGATGTGTAGG - Intronic
1072724186 10:97801464-97801486 TCAGACATAGATGCAGATGTAGG + Intergenic
1073146047 10:101282661-101282683 AGAGTCAGAGGAGGAGATGTTGG - Intergenic
1074434591 10:113423180-113423202 GCAGTCAGGTGAGCAGAAGTTGG - Intergenic
1076551668 10:131282201-131282223 GCTTTCAGAGGTGAAGATTTGGG - Intronic
1076998407 11:310588-310610 GCAGCCAGTCCTGCAGATGTGGG + Intronic
1077000336 11:319171-319193 GCAGCCAGTCCTGCAGATGTGGG - Intergenic
1077394628 11:2315017-2315039 GCACTCAGAGGAGAAGAAGTAGG + Intronic
1078064839 11:8071690-8071712 GCAGGCTGAGATGCAGATATGGG + Intronic
1078667603 11:13339564-13339586 GCAGTCAGAGGGCCAGGTGTGGG - Intronic
1082801451 11:57417831-57417853 GCAGACAGAGATGAAGATGAAGG + Exonic
1083011428 11:59403919-59403941 CCAGTCAGAAGTGCAGATAAAGG - Intergenic
1083654568 11:64223283-64223305 GCAGACAGAGGGGCAAATGGTGG - Intronic
1083700701 11:64475959-64475981 ACAGTGAGAGATGAAGATGTGGG + Intergenic
1084298525 11:68229114-68229136 GTACTCAGGGGTGCAGAGGTGGG - Intergenic
1084309116 11:68305945-68305967 GAAGTCTGAGGTGGAGGTGTTGG + Intergenic
1084687377 11:70704457-70704479 GCACACAGGGGTGCATATGTGGG + Intronic
1086572404 11:88300622-88300644 GCAGTCAGTGGTGCAGGTTTGGG + Exonic
1086837934 11:91648661-91648683 GAAGTCAGATGTGCAGATCTTGG - Intergenic
1086968763 11:93057633-93057655 GCAGTCAGGGCTACAGATGCTGG - Intergenic
1089868587 11:121652733-121652755 GCTTTCAGAGGTGGAGATGTGGG + Intergenic
1097190727 12:57218185-57218207 GCAGGCAGAGGTCCAAGTGTTGG - Intronic
1102052808 12:109875336-109875358 GCAGGCAGAGGGGCTGATGTGGG + Intronic
1102407670 12:112687740-112687762 TCACTCAGAGGTGAAGAGGTTGG - Intronic
1104795357 12:131513398-131513420 GCAGTCAGGGGCTCAGATGCTGG - Intergenic
1105278060 13:18947704-18947726 GCAGCTGGGGGTGCAGATGTGGG - Intergenic
1107234895 13:38156322-38156344 GCATTCAGAGATGAAGGTGTTGG - Intergenic
1107252167 13:38377254-38377276 GTAGTAACAGGTGCAGATGCTGG + Intergenic
1113644240 13:111981142-111981164 GCAGACTGAGGTCCAGGTGTGGG + Intergenic
1115491963 14:33966439-33966461 GCAATCAGATATGCAGATATCGG + Intronic
1115536353 14:34376830-34376852 GTAGTCAGATATGCAGATATAGG - Intronic
1115794370 14:36916875-36916897 GCACACAGAGGAGCAGATTTAGG - Intronic
1117058130 14:51933738-51933760 GCAGACAGAAATGCAGATGCAGG + Intronic
1117287699 14:54302826-54302848 GCAGTCACAGGGGAAGGTGTTGG + Intergenic
1117754382 14:58958800-58958822 AAAGGCAGAGGGGCAGATGTGGG + Intergenic
1117777936 14:59201259-59201281 GTAGTTATAGTTGCAGATGTGGG + Intronic
1118368835 14:65118672-65118694 ACAGTGAGATGTGCTGATGTGGG + Intergenic
1119908043 14:78323374-78323396 GCAGTCAGAAATGCAGAGTTAGG - Intronic
1121588313 14:95079118-95079140 ACATAGAGAGGTGCAGATGTGGG + Intergenic
1122139130 14:99651879-99651901 GCAGTGAGCTGTGCTGATGTAGG + Intronic
1122540139 14:102493480-102493502 GGGTTCAGAGGTGCAGATTTGGG - Intronic
1122540501 14:102495435-102495457 GGATTCAGAGGCGCAGATTTGGG + Intronic
1122917167 14:104864689-104864711 GGGGTCAGAGGTGGAGATGTCGG + Intergenic
1124032096 15:26020979-26021001 ACAGGCAAAGGTGCAGAGGTAGG + Intergenic
1124465606 15:29936548-29936570 GCAATCAGAACTGCAGATGTGGG - Intronic
1125033553 15:35097083-35097105 GCATTTAAAGGTGCATATGTTGG - Intergenic
1125158560 15:36617040-36617062 CCAGTTAGAGTTGCAGCTGTGGG + Intronic
1126134041 15:45373654-45373676 GCAATCAGAGCAGAAGATGTTGG - Intronic
1127473866 15:59314135-59314157 GTAGCCAGAGGGGCAGAGGTGGG + Intronic
1127584015 15:60364808-60364830 ACAGTAGGAGGTGCATATGTGGG + Intronic
1129075166 15:72988781-72988803 GAAGTCAGAGGTCAAGATGTTGG - Intergenic
1129755359 15:78094778-78094800 GAAGTCAGAGCTGGAGGTGTGGG + Intronic
1129909240 15:79212545-79212567 GCAGTCAGAGGAGTAGATTCAGG - Intergenic
1132458308 16:36405-36427 GCAGACACAGGTGCAGACGCAGG + Intergenic
1133418656 16:5626246-5626268 GCAGTCAGAGATCAAGGTGTTGG + Intergenic
1133923907 16:10179421-10179443 GCAGTTAGAGGAACAGAGGTGGG - Intronic
1135067333 16:19321551-19321573 GCACTCAGAGAAGCAGAGGTGGG - Intronic
1135813130 16:25607977-25607999 TCAGCCAGTGGAGCAGATGTTGG + Intergenic
1136680976 16:31962081-31962103 GCAGTGTGAGGTGCAGCTGGTGG + Intergenic
1136855022 16:33648442-33648464 GGAGTCAGCGCTGCAGATCTTGG + Intergenic
1136888503 16:33950246-33950268 GCAGTGTGAGGTGCAGCTGGTGG - Intergenic
1138342792 16:56301740-56301762 TCAGTCAGAGTGCCAGATGTGGG + Intronic
1139478553 16:67215663-67215685 GCAGTCAGAGGAGCCCAAGTTGG - Intronic
1139827110 16:69766117-69766139 GCTGTCTGAGGGGCAGGTGTAGG - Intronic
1141382053 16:83585560-83585582 GCAGTTAGAAGTGTAGATCTGGG + Intronic
1203083950 16_KI270728v1_random:1167576-1167598 GCAGTGTGAGGTGCAGCTGGTGG + Intergenic
1143561128 17:7695825-7695847 GCAGTGGGAGGGACAGATGTGGG - Intronic
1145387142 17:22422502-22422524 GCAGGAAGAGTTCCAGATGTTGG + Intergenic
1145827425 17:27887527-27887549 GTGGTGAGAGGTGCAGATGAGGG - Intronic
1149132113 17:53315476-53315498 GAAGTAAGAGGTGCAGACTTGGG - Intergenic
1150445736 17:65225840-65225862 GCAGTGGGAGCTGCAGGTGTTGG + Intronic
1152407571 17:80106455-80106477 GAAGCCAGCTGTGCAGATGTTGG + Intergenic
1152917885 17:83051500-83051522 GCAGCCGGAGCTGCAGATCTCGG + Intronic
1152962276 18:86961-86983 GCAGACACAGGTGCAGACGCAGG + Intergenic
1153853167 18:9116528-9116550 ACAGTCAGAGGTGCACAAGGGGG - Intronic
1156269022 18:35513961-35513983 GCAGTCAGAGGTGGGGCTGTGGG - Intergenic
1157214213 18:45769097-45769119 GTAGTGAGATGTGCAAATGTAGG - Intergenic
1157301466 18:46482802-46482824 CCAGGGAGAGGTGCAGATGTGGG + Intronic
1157306537 18:46521509-46521531 GATGTCAGAGGTGAAGAAGTTGG + Intronic
1158899155 18:61946595-61946617 GCAGTCTGGGGTGAAGAAGTTGG - Intergenic
1160058643 18:75509705-75509727 GCAGTCAGTGTTGGGGATGTGGG - Intergenic
1160607594 18:80064001-80064023 CCAGACAGAAGTGCAGATGAGGG + Intronic
1160670032 19:357492-357514 GCAGGCACAGGTGTAGGTGTAGG + Intergenic
1163710442 19:18843391-18843413 GCAGACAGTGGTGCAAATGTTGG + Intronic
1163956272 19:20644289-20644311 GCAGTCAGGTCTGCAGATGCTGG - Intronic
1164116330 19:22222881-22222903 GCAGTCAGATCTGCATATGGTGG + Intergenic
1164305389 19:24001334-24001356 GCTGTCCCAGGTGCAGATCTTGG - Intergenic
1164317092 19:24100344-24100366 GAATTCAGAGCTGCAGATTTAGG - Intronic
1164484287 19:28641500-28641522 GCAGACAGAGATGCAGAGGATGG - Intergenic
1167579171 19:50331929-50331951 GCAGAGAGAGTTGCAGAAGTGGG + Intronic
1168073568 19:53966017-53966039 GGAGTAAGAGGTGCAGTCGTAGG + Intronic
1168290963 19:55357387-55357409 GCGGTCAGAGGTGCAGCAGGGGG - Intronic
925222495 2:2153407-2153429 GCAGTCAGAGCTGGAGGTGCTGG + Intronic
925786309 2:7434448-7434470 GGAGTTAGAGGTGGAGATCTGGG - Intergenic
925870885 2:8269403-8269425 GAAGTCAGAGATCAAGATGTTGG - Intergenic
927730516 2:25467205-25467227 GTAGTCAAAGGTACAAATGTTGG - Intronic
928814995 2:35282992-35283014 GCAGTTAGAGGAGGAGATGAGGG + Intergenic
928822036 2:35373017-35373039 GCAGTGTGAGGGGAAGATGTGGG + Intergenic
930604016 2:53473562-53473584 GCAGTTAGAGGTTGAGATGCGGG + Intergenic
931953570 2:67392748-67392770 TCAGTCAGAGGTGGAGAAGCTGG + Intergenic
932716114 2:74101576-74101598 GAAGTCAGAGGAGAAGCTGTGGG + Exonic
933177056 2:79186646-79186668 GCAGGGAGAGGTGCAGAGATAGG - Intronic
933177845 2:79195886-79195908 GGGGGCAGAGGTGCAGAGGTAGG + Intronic
935525547 2:104162447-104162469 GCTGGCAGTGGTGAAGATGTTGG + Intergenic
936406483 2:112209273-112209295 GCAGCCGGAGGTGCAGATAAAGG - Intergenic
936458653 2:112694548-112694570 GCACTGAGAGGTGATGATGTGGG - Intergenic
937289454 2:120773467-120773489 GCAGCCTGACGTGCTGATGTTGG + Intronic
938956743 2:136305930-136305952 GGAGTGAGAGGGTCAGATGTTGG - Intergenic
939567030 2:143797309-143797331 GGAGTCAGAGCTGCTGATGCTGG - Intergenic
939813683 2:146867804-146867826 GCACTCAGTGGTGCAGAGGAGGG + Intergenic
940039648 2:149347037-149347059 GCAGTCAGAGGTCAAGGTGCTGG + Intronic
941502411 2:166296404-166296426 GCAGTTTGAGGTGCAAATGTAGG + Intronic
943930684 2:193848096-193848118 GCAGTCAACAGTGCAGGTGTGGG + Intergenic
944166702 2:196729998-196730020 GCAGAAAGAGATGCAGATGTTGG + Exonic
944442961 2:199761261-199761283 GCATGCAGAGAGGCAGATGTGGG - Intronic
945013977 2:205494996-205495018 GCAGTCATAGGAGGAGATGAAGG + Intronic
946339256 2:219057745-219057767 GCCGGCCGAGGTGCAGGTGTAGG + Intronic
946353368 2:219169797-219169819 GGAGGCAGAGGTGCAGGAGTTGG - Intronic
946670323 2:222095979-222096001 GAAGTCTGAGGTCCAGGTGTTGG - Intergenic
948550169 2:238765767-238765789 CCAGTCAGAGATGCACGTGTTGG + Intergenic
1169018548 20:2311213-2311235 GCAGGCAGATGGACAGATGTGGG - Intronic
1170788328 20:19486961-19486983 GCAGTTAGAGGTACAGACATTGG + Intronic
1175272601 20:57745228-57745250 GCAGTCACAGGTGGAGCTGTCGG - Intergenic
1181116238 22:20634102-20634124 GCAGTCACCTGTGCAGGTGTCGG - Intergenic
1181177011 22:21043679-21043701 GGAATCAGAGGAGCAGAGGTGGG + Intergenic
1181550685 22:23637445-23637467 GCAGTCAGCTGTGCACATGTTGG + Intergenic
1181634093 22:24166418-24166440 GTAGCCAGAGGTGCAGAGGAGGG + Intronic
1182659093 22:31912497-31912519 GCAGCCAGAGAAGCAGATGGAGG - Intergenic
1182696450 22:32202231-32202253 ACAGTGAGAGGAGGAGATGTGGG - Intronic
1182919944 22:34070050-34070072 GGTGTCAGAGGTACAGATTTAGG - Intergenic
1183164461 22:36136977-36136999 GCAGTCAGAGGTTAAGATGAGGG + Intergenic
1183345948 22:37307976-37307998 GCAGTCAGAGCTGGTGACGTGGG - Intronic
1184206453 22:43007040-43007062 GAAGTCAGGGATGCAGATGGGGG - Intronic
1184661570 22:45967854-45967876 GCAGTTGGAGGTGCTGATGGGGG - Intronic
950181027 3:10913391-10913413 GAAGTCAGAGGTGGGGAGGTGGG + Intronic
951661815 3:25075124-25075146 ACAGTCTAAGATGCAGATGTGGG + Intergenic
952848897 3:37711869-37711891 GCATTCAGAAGTGCAGCTGCTGG - Intronic
954693135 3:52406461-52406483 GCAGTCACACCTGCAGCTGTAGG + Intronic
954871147 3:53768338-53768360 GCAAGCAGAGGTGCACATGCGGG + Intronic
956226773 3:66969016-66969038 TCAGTCTGTGGTTCAGATGTGGG + Intergenic
960264507 3:115605117-115605139 GCAGGAAGAGGTGCATATTTTGG + Intergenic
960972087 3:123147136-123147158 GAAGTCAGAGATCAAGATGTTGG + Intronic
962207095 3:133443801-133443823 GCAGCTAGAGCTGCAGGTGTGGG - Intronic
965904675 3:173689243-173689265 GTAGTCAGAGGGGGTGATGTTGG - Intronic
967753140 3:193137820-193137842 GAAGACAGAGGTACAGATTTGGG + Intergenic
969188619 4:5499052-5499074 GCAGCCACGGGTGCAGGTGTGGG - Exonic
969641483 4:8401666-8401688 GCAATTAGAGGGGCAGATGGAGG - Intronic
969681983 4:8648283-8648305 GCAGTCTATGGTTCAGATGTGGG + Intergenic
970972968 4:22006109-22006131 GTAGGCACAGGTGCTGATGTTGG + Intergenic
972569176 4:40295093-40295115 GGAGGCAGAGATGGAGATGTAGG - Intergenic
973611813 4:52643162-52643184 GCAGCCAGAGGAGGAGATGGAGG - Intronic
975900744 4:79149262-79149284 GCAGTCAGAAGTGCCTTTGTGGG - Intergenic
975927235 4:79471749-79471771 GCAGCCAGAGGTGGAGAAGGGGG + Intergenic
977839465 4:101684600-101684622 CCAGGCAAAGGTGCAGATCTGGG - Intronic
979441230 4:120751726-120751748 GCAGTAAGAGCCCCAGATGTGGG - Intronic
980220692 4:129909852-129909874 ACATTCAGAGGTGCAAATGAAGG - Intergenic
980255002 4:130368321-130368343 GCAGCAAGAGGTAAAGATGTTGG - Intergenic
983071607 4:163274330-163274352 GAAGTCAGAGGGGCAGATGGAGG - Intergenic
983262049 4:165468052-165468074 GGAGTTGGAGGTGCAGATATAGG + Intronic
983370662 4:166853634-166853656 GCACTCAGAGAGGCAGAGGTAGG + Intronic
986809370 5:11339643-11339665 GCATTAGGAGGTGGAGATGTTGG + Intronic
988012559 5:25508348-25508370 GCAGCCAGGGTTGCAGATGTTGG + Intergenic
988579300 5:32455086-32455108 GCAATAAGGCGTGCAGATGTGGG + Intergenic
989164137 5:38418234-38418256 GCACTCAGTGGGGCTGATGTGGG + Exonic
989474385 5:41857427-41857449 GCCATCTGAGGTCCAGATGTTGG - Intronic
990064459 5:51695748-51695770 CCAGTCAGAGGTGGAGATGAGGG - Intergenic
990371257 5:55120638-55120660 GCTGTGACAGGTGCAGACGTGGG - Intronic
992207453 5:74444766-74444788 GCAGCCAGTGGTGCAGTTTTGGG - Intergenic
992370541 5:76139180-76139202 AAAGTCATAGATGCAGATGTTGG + Intronic
996178408 5:120388682-120388704 GCAGGCATAGGAGCAGATGTAGG - Intergenic
997911938 5:137883501-137883523 GTAGTCAGAGCTTCAGATGCAGG + Exonic
999880250 5:155855119-155855141 TCAGGCAGAGATTCAGATGTTGG - Intergenic
1000720849 5:164704683-164704705 GGAGGCAGAGGTGAAGATGAAGG + Intergenic
1001530210 5:172455955-172455977 GAAGTCAGAGGAGCAAATGGAGG - Intergenic
1002173396 5:177387801-177387823 GGTGACAGAGGTGCCGATGTTGG - Exonic
1003031266 6:2603460-2603482 GGAGTCAGGGGTGCTGATGATGG + Intergenic
1003502666 6:6715185-6715207 GGAGACAGAGTTGCAGCTGTTGG - Intergenic
1005518054 6:26573110-26573132 GCAGTTGAAGGTGCAGATGTTGG - Intergenic
1005568066 6:27116398-27116420 GCAGTCAGAGGGGAAGAAGGAGG - Intergenic
1007936927 6:45740842-45740864 CCAGTCAGAGGTGCAGTTCTAGG + Intergenic
1008473291 6:51908727-51908749 GCAGTTACATGTGCAGATCTTGG - Intronic
1010331242 6:74626453-74626475 GCAGCCACAGCTGCAGATATGGG - Intergenic
1011432198 6:87299644-87299666 GCAGTCAAAGCTCCAGATTTTGG + Intronic
1012052694 6:94363162-94363184 GAAGTCAGAGGTTCATATGTAGG + Intergenic
1016749626 6:147618497-147618519 GCAGCCAGTGGTGAAGATATAGG + Intronic
1018282319 6:162200142-162200164 GCAGTCAGGTGTGCAAGTGTGGG - Intronic
1018491051 6:164293703-164293725 GAAGTCCAAGGTGAAGATGTTGG - Intergenic
1019607102 7:1915447-1915469 GCAGGCAGAGGTGCTGAGGACGG + Intronic
1020832531 7:13109975-13109997 TCAGCCAGAAGGGCAGATGTCGG - Intergenic
1021656872 7:22881614-22881636 GCAGGCAGGGGGGCAGGTGTGGG - Intergenic
1022194831 7:28054726-28054748 GCAGGAAGAGGTGCAGACGCTGG + Intronic
1022474281 7:30699973-30699995 GCAGGCAGAGGAGGAGGTGTGGG + Exonic
1022617605 7:31947925-31947947 GCAGTAAGATGTGCAGGTGATGG + Intronic
1023167576 7:37357940-37357962 GCAGTCTGTGGTGCATATTTGGG + Intronic
1025834267 7:65080787-65080809 GCAGTCAGAGGTCAAGCTGGTGG + Intergenic
1025904040 7:65770308-65770330 GCAGTCAGAGGTCAAGCTGGGGG + Intergenic
1027372403 7:77519884-77519906 GCAGACAGAGGTCCAGGGGTGGG + Intergenic
1028161976 7:87496308-87496330 GCGGTCAGAGTTTTAGATGTTGG - Intergenic
1029295232 7:99535141-99535163 ACAGCCAGAGGTGCAGCAGTGGG + Intergenic
1030602356 7:111607054-111607076 GCTGTCAGAAGGGCAGATGGGGG + Intergenic
1032741915 7:134748020-134748042 GCAGGCAAAGCTGCAGAGGTAGG + Intronic
1033126687 7:138712888-138712910 GCAGTCAGTGGTGGTAATGTTGG - Intronic
1033538180 7:142331340-142331362 GCAGACAGAGGAGCGGCTGTGGG + Intergenic
1033540599 7:142352553-142352575 GCAGACAGAGGAGCGGCTGTGGG + Intergenic
1033551861 7:142454861-142454883 GCAGACAGAAGAGCAGCTGTGGG + Intergenic
1034449891 7:151131690-151131712 GCCGTCAGAGATGCTGAAGTTGG + Intronic
1034674467 7:152882695-152882717 GAAGTCTGAGGTCCAGGTGTGGG + Intergenic
1035397028 7:158541429-158541451 GCAGTGTCTGGTGCAGATGTGGG - Intronic
1035926227 8:3730596-3730618 TAAGTGAGAGGTGCACATGTAGG - Intronic
1037438651 8:18891608-18891630 GCTCTCGGAGGTGCAGGTGTTGG - Intronic
1038503783 8:28067110-28067132 GGAGCCAGAGATGCTGATGTTGG + Intronic
1039547035 8:38417748-38417770 GCAGGCAGCGGAGCAGGTGTGGG + Intronic
1040825090 8:51611956-51611978 GAAGCCAGAGGAGCAGATGCAGG + Intronic
1041117175 8:54551169-54551191 GGAATCAGGCGTGCAGATGTAGG - Intergenic
1041748779 8:61236893-61236915 GCAGTCAGAGGTGCAGATGTTGG - Intronic
1042189810 8:66174602-66174624 GCAGACAGAGGGGCAGCAGTTGG - Exonic
1042212802 8:66398290-66398312 TCAGTCAGAGGACCAGATTTGGG + Intergenic
1042640955 8:70933404-70933426 GTAGTCAGAGTTGGAGATGAAGG + Intergenic
1043511909 8:80958163-80958185 GCAGCAAGAGAGGCAGATGTGGG + Intergenic
1047781411 8:128114423-128114445 GTGGAAAGAGGTGCAGATGTTGG + Intergenic
1048028381 8:130607754-130607776 GCAGTTAGAGCTGCAGGTGATGG - Intergenic
1049174299 8:141182158-141182180 GGTGTCAGGGATGCAGATGTAGG + Intronic
1049320900 8:141995725-141995747 GAAGTCTGAAGTGCAGTTGTGGG + Intergenic
1049327281 8:142029415-142029437 GAAGTCTGAGATGGAGATGTTGG + Intergenic
1049344023 8:142128944-142128966 GCAGCGAGAGGGGCAGATGCCGG + Intergenic
1049664836 8:143838334-143838356 GCAGACCCAGGTGCAGATGTTGG + Intronic
1049738504 8:144222672-144222694 GCAGGCATAGGTGTGGATGTGGG + Intronic
1049738512 8:144222724-144222746 GCAGGCACAGGTGCAAGTGTGGG + Intronic
1052447428 9:28581268-28581290 GCTGTGAGAGATGCAGTTGTTGG - Intronic
1052664680 9:31479785-31479807 TTAGTTAGAGGTGCAGATATAGG - Intergenic
1053551384 9:39082788-39082810 GCAGTGATGGGTGCAGATGAAGG - Intronic
1053815497 9:41902906-41902928 GCAGTGACGGGTGCAGATGAAGG - Intronic
1054615099 9:67284534-67284556 GCAGTGACGGGTGCAGATGAAGG + Intergenic
1055730011 9:79270794-79270816 GCCTACAGAGGTGCAGATGTAGG + Intergenic
1057294072 9:93825285-93825307 CCAGGGAGAGGTGCAGATCTGGG - Intergenic
1057580432 9:96282592-96282614 CCAGGCAGAAGTGCAGATGAGGG - Intronic
1057907312 9:98992851-98992873 GCAGGCACTGGGGCAGATGTGGG + Intronic
1058956142 9:109950503-109950525 CCAGACAGAGGAGCAGGTGTAGG - Intronic
1060183171 9:121547695-121547717 CCCCTCAGAGGTGCAGATGTGGG + Intergenic
1062735866 9:138137156-138137178 GCAGACACAGGTGCAGACGCAGG - Intergenic
1185639438 X:1578772-1578794 GAAGTCTGAGGTCAAGATGTGGG - Intergenic
1185888171 X:3801655-3801677 GAAGTAAGTGATGCAGATGTAGG + Intergenic
1186609691 X:11127147-11127169 ACAGCCAGAAGTGCAGAGGTTGG + Intergenic
1190002870 X:46706561-46706583 GCAAGCAGAGGTTTAGATGTAGG - Intronic
1190232603 X:48593974-48593996 GGAGGCAGAGGTGCCCATGTTGG + Intronic
1190234528 X:48605494-48605516 GGAGACAGAGCTGCAGAAGTTGG + Exonic
1190727013 X:53196384-53196406 ACAGGCAGATGGGCAGATGTTGG - Intronic
1192080671 X:68045019-68045041 GCAGACAGGTGTGCAGATTTTGG - Exonic
1193036643 X:76958207-76958229 GCAGACGGGGGTGCTGATGTTGG + Intergenic
1195579565 X:106485684-106485706 CAAGTCAGAGGGGCAGGTGTAGG + Intergenic
1196352887 X:114753934-114753956 GAAGTCAGAGGTCAAAATGTCGG + Intronic
1197726424 X:129779969-129779991 GCAGTCAGAGTGGCAGCTGAAGG + Exonic
1198097036 X:133390180-133390202 GCAGTTTGAGGTGAAGAAGTAGG - Intronic
1199672379 X:150158238-150158260 GCAGTCACAGCTGGAGAGGTGGG + Intergenic
1199815669 X:151394879-151394901 GAAGTCTGAGATGGAGATGTTGG - Intergenic
1200047985 X:153412719-153412741 GCAGAGGGAGGTGCAGAGGTGGG + Intergenic
1201730853 Y:17201288-17201310 GCAGACCGAGGTGCAGCTGAGGG - Intergenic