ID: 1041748783

View in Genome Browser
Species Human (GRCh38)
Location 8:61236912-61236934
Sequence CTGCCTACAATGCTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041748779_1041748783 -4 Left 1041748779 8:61236893-61236915 CCAACATCTGCACCTCTGACTGC 0: 1
1: 0
2: 0
3: 30
4: 255
Right 1041748783 8:61236912-61236934 CTGCCTACAATGCTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041748783 Original CRISPR CTGCCTACAATGCTGGTGGA TGG Intronic
No off target data available for this crispr