ID: 1041751110

View in Genome Browser
Species Human (GRCh38)
Location 8:61261719-61261741
Sequence TTCTTATGAGGGCCCCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041751110_1041751114 5 Left 1041751110 8:61261719-61261741 CCAGGAAGGGGCCCTCATAAGAA 0: 1
1: 0
2: 1
3: 29
4: 193
Right 1041751114 8:61261747-61261769 ATCTGCTGATGTCTTGATCTTGG 0: 7
1: 80
2: 365
3: 977
4: 2058

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041751110 Original CRISPR TTCTTATGAGGGCCCCTTCC TGG (reversed) Intronic
900379369 1:2376246-2376268 ATCTCTTGAGGGTCCCTTCCTGG + Intronic
900731551 1:4265059-4265081 TCCTGATGAGGTCCTCTTCCTGG + Intergenic
907810180 1:57861355-57861377 TTCTGATGAGGGCCCTCTTCTGG + Intronic
910110187 1:83674544-83674566 CTCTGATGAGGGCCCTCTCCCGG - Intergenic
910117802 1:83751683-83751705 TCCTAGTGAGGGCCTCTTCCTGG + Intergenic
910706550 1:90135972-90135994 TTCTGCTGAGGGTCACTTCCTGG + Intergenic
910968109 1:92828226-92828248 TTCTGGTGAAGGCCTCTTCCGGG + Intergenic
911357785 1:96843417-96843439 CTCTGATGAGGCCCACTTCCTGG + Intergenic
912771338 1:112466392-112466414 GTCTGAAGTGGGCCCCTTCCTGG - Intergenic
912968546 1:114258739-114258761 TCCTTATGAGTCTCCCTTCCTGG + Intergenic
916273825 1:162972054-162972076 TTCCTATCAGGCCCACTTCCTGG - Intergenic
917742351 1:177972948-177972970 GTCTGGTGAGGGCCACTTCCTGG - Intronic
919298584 1:195733200-195733222 TTCTTATGAGCGTCCTGTCCAGG - Intergenic
920974908 1:210776613-210776635 TTCTGGTGAGGGCCCCCTTCTGG - Intronic
923249293 1:232165128-232165150 TTCTAGTGAGGGCACCCTCCTGG - Intergenic
923348472 1:233080567-233080589 TTCTATTAAGGGCCTCTTCCAGG + Intronic
1062818737 10:518610-518632 TTCTGGTGTGGGCCCCTTCCTGG - Intronic
1062955332 10:1536295-1536317 TTGCCATGAAGGCCCCTTCCTGG - Intronic
1063133610 10:3198444-3198466 TGCTGATGAGGGCCTTTTCCTGG + Intergenic
1063419263 10:5898252-5898274 GTCTGGTGAGGGCCGCTTCCTGG + Intronic
1064623807 10:17241774-17241796 GTCTGGTGAGGGCCACTTCCTGG - Intergenic
1065871384 10:29959184-29959206 TTCTGGTGAGGGCCTCTTCCTGG - Intergenic
1065991493 10:31014345-31014367 TTCTGATAAGGGCCACTTCTGGG + Intronic
1066072547 10:31834435-31834457 GTCTGGTGAGGGCACCTTCCTGG - Intronic
1066431012 10:35351732-35351754 TTCTTATGAGATACCCTTACAGG + Intronic
1067221222 10:44345747-44345769 GTCTGATGAGGGCCTCTTCCTGG + Intergenic
1068035803 10:51758573-51758595 TTCTTCTCTGGGCCTCTTCCAGG + Intronic
1069179558 10:65341213-65341235 TTCTTAATTGGGCTCCTTCCAGG + Intergenic
1070763262 10:79039141-79039163 TTCTGATGAGGGCCACATGCTGG - Intergenic
1071010178 10:80929597-80929619 TTCTTGTGAGGGCCCTCTTCTGG + Intergenic
1074098040 10:110331161-110331183 TTCTTCTGAGGGCTCTCTCCTGG + Intergenic
1074424987 10:113342841-113342863 TGATTATGAAGGCCTCTTCCAGG + Intergenic
1075053160 10:119198330-119198352 TTCTGATGAGGGCCCTCTTCTGG + Intergenic
1075634261 10:124019598-124019620 TCCTTATGAAGGCTCCCTCCCGG + Intronic
1076601216 10:131658157-131658179 TTCTGGTGAGGGCCTCTTCTGGG - Intergenic
1077341125 11:2026819-2026841 TTCTTCTGAGTTCCACTTCCTGG - Intergenic
1079159046 11:17975581-17975603 TTCTTAGGGGAGCCCCTTTCAGG - Intronic
1079335699 11:19568624-19568646 TTCTTATGAAAGCACCTCCCAGG + Intronic
1079355485 11:19727000-19727022 GTCTTATGAGGTCCTCTTCTAGG - Intronic
1079620255 11:22545351-22545373 ATCTTATCAGAGGCCCTTCCTGG + Intergenic
1081611881 11:44567766-44567788 TTCTTGTGTAAGCCCCTTCCCGG - Intronic
1083283686 11:61643989-61644011 GTCTGGTGAGGGCCCCTTCTGGG + Intergenic
1085823528 11:79818546-79818568 TTCTTATGTGGGCCCCAGACTGG - Intergenic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1090348068 11:126086938-126086960 TTCATATGTGGTCCACTTCCTGG + Intergenic
1202824110 11_KI270721v1_random:82008-82030 TTCTTCTGAGTTCCACTTCCTGG - Intergenic
1093600302 12:21013521-21013543 TTCTGATGAGGGCCTCTTTCTGG + Intergenic
1093640610 12:21523295-21523317 TTCTGGTGAGGGCCCTTTTCTGG - Intergenic
1093773139 12:23040312-23040334 TTCCTATGAGGACCACTTTCAGG - Intergenic
1094398570 12:30036015-30036037 TTCTTGTAAGGGCCTCTTCCTGG + Intergenic
1095747443 12:45675462-45675484 TTCTTCTCAGGGTCCTTTCCTGG - Intergenic
1096488347 12:51999199-51999221 TTCACATGAAGGCCCCTTACAGG + Intergenic
1098710312 12:73750115-73750137 TTCTGGTGAGGCCCTCTTCCTGG + Intergenic
1101510133 12:105385449-105385471 GTCTGGTGAGGGCCCCTTTCCGG - Intronic
1102499864 12:113344564-113344586 TTCTGGTAAGGGCCCCTCCCAGG - Intronic
1103178957 12:118891023-118891045 TTCTTGTGAGGGTCCTTTTCTGG + Intergenic
1103830264 12:123773590-123773612 ATCTGGTGAGGGCCACTTCCTGG + Intronic
1104045005 12:125155692-125155714 TTCTCATGAGGGTACCTTCTGGG + Intergenic
1104809736 12:131612923-131612945 ATCTGATGAGGACCACTTCCTGG + Intergenic
1106382422 13:29253090-29253112 TTCTTCTCAGGGCCTCATCCTGG + Intronic
1106749465 13:32745631-32745653 TTCTGGTGAGGGCCCTCTCCAGG + Intronic
1109622713 13:64930087-64930109 GTCTGGTGAGGGCCACTTCCTGG + Intergenic
1110933495 13:81253136-81253158 TTCTCATGAAGGCCTCTTCCTGG + Intergenic
1112445875 13:99463608-99463630 TTCTTTTGAGAGCTCTTTCCTGG - Intergenic
1112804245 13:103145488-103145510 GTCTAATGAGGGCCCACTCCTGG + Intergenic
1112977083 13:105333690-105333712 GTCTTGTGAGGCCCTCTTCCTGG + Intergenic
1116637437 14:47415774-47415796 TTCTAGTGAGGGCCTCCTCCAGG + Intronic
1116806655 14:49500530-49500552 TTCTGGTGAGGGCCTCTTCCAGG + Intergenic
1117816733 14:59606546-59606568 TTCTGTTGAGGGCCCTTGCCTGG - Intronic
1117950103 14:61074419-61074441 TCCTGGTGAGGGCCTCTTCCTGG + Intronic
1118759507 14:68871446-68871468 TTCTTATGAGGCCACCTTTTGGG + Intergenic
1120144659 14:80966837-80966859 GTCTTGTGAGGGCTGCTTCCTGG + Intronic
1121183822 14:91949464-91949486 TTCTCATGAGGGTCCTCTCCTGG + Intergenic
1121882762 14:97515243-97515265 TTCTGGTGAGGGCCACTTCCTGG + Intergenic
1123002839 14:105305502-105305524 GTCTGGTGAGGGCCACTTCCTGG - Exonic
1124242128 15:28037416-28037438 TTCCCATGAGGGACCCCTCCTGG - Intronic
1126924261 15:53565167-53565189 TTCTCATGAGGTTCCCTTGCTGG - Intronic
1126932659 15:53672147-53672169 TTCTTATTAGGGCCCCTATTAGG - Intronic
1128300781 15:66565279-66565301 CTCTTCTGGGGACCCCTTCCGGG + Exonic
1128906161 15:71469539-71469561 TTCTTCTGAGAGCCCCCTTCCGG + Intronic
1129523666 15:76200984-76201006 GTGTTCTGAGGGCCCCTCCCAGG - Intronic
1131733491 15:95306924-95306946 TTCTGGTGAGGGCCCTTTACTGG + Intergenic
1132996454 16:2826006-2826028 TGCTGGTGAGGGCTCCTTCCTGG - Intronic
1133270258 16:4607870-4607892 TTCCTGGGAGGGCCCATTCCTGG + Intergenic
1135323955 16:21514100-21514122 TTCTTCTGAGAGCACCTCCCTGG + Intergenic
1136098790 16:27978120-27978142 TTCTGCTGAGGGCCCGTGCCAGG - Intronic
1136335438 16:29607368-29607390 TTCTTCTGAGAGCACCTCCCTGG + Intergenic
1137763347 16:50958541-50958563 GTCTGGTGAGGGCCTCTTCCTGG + Intergenic
1142036164 16:87863209-87863231 TTCTTCTGAGAGCACCTCCCTGG + Intronic
1142425788 16:90001599-90001621 TTATTAGGAAGGCCCCTTCTGGG + Intergenic
1144244163 17:13346594-13346616 TCCATGTGAGGGCACCTTCCGGG - Intergenic
1147332786 17:39708659-39708681 ATCTTCTGAGGGCGTCTTCCCGG - Intronic
1152917260 17:83047166-83047188 GTCTAGTGAGGGCCCCTTCCTGG + Intronic
1155201489 18:23521781-23521803 TTCTTCTGAGGCCTCCCTCCTGG + Intronic
1155603135 18:27572469-27572491 TTCTGGTGAGGTCCACTTCCTGG + Intergenic
1157222114 18:45835952-45835974 TTCTCATGATGGCCCCGTGCAGG - Intronic
1159781623 18:72667039-72667061 TTCTGGTGAGGTCCACTTCCTGG - Intergenic
1161117202 19:2504338-2504360 TTCTTATGAGGGACCCTGTGAGG - Intergenic
1161629794 19:5347908-5347930 TTCTTTTGAGGTTCCTTTCCAGG + Intergenic
1163336411 19:16675139-16675161 TTCTAATGAGGGCCCTCTTCTGG + Intronic
1163742656 19:19025666-19025688 TTCCTAGGAGGGAACCTTCCTGG + Exonic
1164518026 19:28953009-28953031 TTCTGGTGAGGGCCTCTTCCAGG - Intergenic
1165153428 19:33773806-33773828 TTCTTATCAGTGCACCTTGCAGG + Intergenic
1167376723 19:49116221-49116243 TGAAGATGAGGGCCCCTTCCAGG - Intronic
925067575 2:940518-940540 TCCTGGTGAGGGCCGCTTCCTGG + Intergenic
925164886 2:1709853-1709875 TTCTGGTGAGGGCCTCTTGCAGG - Intronic
926336549 2:11866896-11866918 TTCTGATGAGGGCCCTCTTCTGG + Intergenic
926353555 2:12019552-12019574 TTCTTCTGAAGGCCCTTTCTGGG + Intergenic
926392300 2:12405763-12405785 TTCTGGTGAGGGCCTCTTCCTGG - Intergenic
930001497 2:46864746-46864768 TTCTGATGAGGGCCTCTTCCAGG + Intergenic
931374323 2:61694529-61694551 TTCCCATAAGGGCCCCATCCAGG - Intergenic
933298838 2:80520539-80520561 TTCTGATGAGGGCCTTTTTCCGG + Intronic
934930079 2:98415003-98415025 GTCTGGTGAGGGCCTCTTCCTGG + Intergenic
935792710 2:106608682-106608704 TTCTGGTGAGGGCCCTCTCCAGG + Intergenic
935804174 2:106729916-106729938 TTCTGCTGAGGGCCTCTTCCTGG - Intergenic
939608513 2:144281771-144281793 TTCTTCTGAGGTCTCTTTCCTGG - Intronic
943163069 2:184280342-184280364 TTCTTGTGAGGCCCTCTTCCAGG + Intergenic
944036283 2:195298234-195298256 GTCTGATCAGGGCCCCCTCCTGG - Intergenic
945782304 2:214190790-214190812 ATCTGGTGAGGGCGCCTTCCTGG - Intronic
946100605 2:217317330-217317352 GTCTTATGAGGGCCCTCTCAAGG + Intronic
946216397 2:218187073-218187095 TTATGATGAGGGCACCCTCCTGG + Intergenic
947383235 2:229564899-229564921 TTCCACTGAGGGCCCGTTCCTGG + Intronic
947810317 2:233000069-233000091 CTCTGGTGAGGGCCCCATCCTGG + Intronic
948044061 2:234929068-234929090 TTCTTCTGAGAGCCCATTTCAGG - Intergenic
1173334210 20:42099828-42099850 TTCTTCCGAGGGCCTTTTCCTGG + Intronic
1173817221 20:45997548-45997570 TTCTTCTGAGCCCCCCTTCCTGG - Intergenic
1173929299 20:46805440-46805462 TTCTTCTGAGGCCCCCTCCTTGG + Intergenic
1176073440 20:63238165-63238187 TTCCTGTGAGGGCCCCTTTTCGG + Intronic
1178887389 21:36494728-36494750 TTCTCCTGAGGCCCCCTCCCTGG - Intronic
1179315711 21:40242645-40242667 TTGTTATGATGGCACCATCCAGG + Intronic
1179358427 21:40683052-40683074 TTCTGATGGGGGCCTCATCCTGG - Intronic
1181665618 22:24394293-24394315 TTCTTGTGAGGGCATCTTCCAGG + Intronic
1184133560 22:42532452-42532474 ATCTGGTGAGGGCCTCTTCCTGG - Intergenic
1184334574 22:43845581-43845603 TTCCTACGAGGGCTCCTCCCTGG + Intronic
1184591027 22:45483422-45483444 ATCTTATGAGGGCTCCTTACTGG - Intergenic
950234678 3:11308446-11308468 TTCCTTTGAGAGCCCCTCCCAGG + Intronic
950944620 3:16932026-16932048 TTCTGGTGAGGGCCCTCTCCAGG - Intronic
953789017 3:45932157-45932179 TGCTCCTCAGGGCCCCTTCCAGG + Intronic
954697685 3:52436283-52436305 TCCTTGAGAAGGCCCCTTCCTGG - Intronic
955105418 3:55893090-55893112 TTCTGGTGAGGGCCCTCTCCTGG - Intronic
957251089 3:77771921-77771943 GTCTGGTGAGGGCCCATTCCTGG - Intergenic
960260102 3:115557613-115557635 GTCTGATGAGGGCCCTTTTCTGG + Intergenic
963627240 3:147689023-147689045 GTCTGGTGAGTGCCCCTTCCTGG + Intergenic
963776939 3:149449313-149449335 TTCTCATCATGGCCCCTTACTGG + Intergenic
964340870 3:155707123-155707145 GTCTTGTGAGGGCCCTTTCCTGG - Intronic
966183359 3:177206551-177206573 TTATGGTGAGGGCCTCTTCCTGG + Intergenic
966774241 3:183530001-183530023 TTCTGGTGAAGTCCCCTTCCTGG - Intronic
967795350 3:193593266-193593288 TGCTGCTGAGGGCCACTTCCTGG + Exonic
969395365 4:6917196-6917218 TTCTTAAGTGGGCAGCTTCCAGG - Intronic
969490049 4:7494452-7494474 TTCTGGTGTGGGCCTCTTCCTGG + Intronic
969613912 4:8241507-8241529 TCCTAATGGGGGCACCTTCCTGG - Intronic
969630340 4:8332300-8332322 TTCTCGTGAGGGCCTCTTTCTGG - Intergenic
974821992 4:67078842-67078864 TTCTTGGGAGGGCCTCTTTCTGG + Intergenic
977980644 4:103317417-103317439 TTCTATTGAGGTCCTCTTCCTGG + Intergenic
979437717 4:120713872-120713894 TTCACATGAGGGCCCTTTTCTGG + Intronic
982780199 4:159482607-159482629 GTCTAGTGAGGCCCCCTTCCTGG + Intergenic
984966955 4:185148127-185148149 TTCTGATGAGGGCCCTCTTCTGG + Exonic
985584816 5:725213-725235 GTCTGATGAGAGCCCCTTCCTGG - Intronic
985584838 5:725309-725331 GTCTGATGAGAGCCCCTTCCCGG - Intronic
985598319 5:809527-809549 GTCTGATGAGAGCCCCTTCCGGG - Intronic
985598342 5:809623-809645 GTCTGATGAGAGCCCCTTCCCGG - Intronic
986571513 5:9170679-9170701 TTCTCATGAGGACCCTTTTCTGG - Intronic
988655269 5:33204384-33204406 GTCTGGTGAGGGCCCCTCCCTGG - Intergenic
989789239 5:45376437-45376459 GTCTGATGAGGGCAACTTCCTGG - Intronic
989804644 5:45587980-45588002 TTCTGATGAGGGCCCTTTTCTGG - Intronic
992325010 5:75651876-75651898 TTCTGATGAGGCCCTCTTCCTGG + Intronic
992529815 5:77643353-77643375 CTCTTCTGAGTGCCCCTGCCCGG + Intergenic
993068880 5:83133877-83133899 TGCATATGAGGGCCCCTCTCTGG + Intronic
993269647 5:85777948-85777970 TTCTAATGAGAGCTCCTTGCAGG + Intergenic
993882649 5:93381090-93381112 TTCTGGTGAGGGCCCTCTCCTGG - Intergenic
994475022 5:100256694-100256716 TTCTTCTGAGGCCGCTTTCCTGG + Intergenic
997030846 5:130125775-130125797 TTCTTATGAGAGCAGCTTTCTGG - Intronic
997208463 5:132064223-132064245 TTCGGAGGAGGGCCCCATCCTGG - Intergenic
997443663 5:133926157-133926179 TTCTGAGGAGGCCCTCTTCCTGG + Intergenic
997469325 5:134108147-134108169 TTCTTTTTAAGGCCCATTCCTGG - Intergenic
999962693 5:156774359-156774381 TTCTGGTGAGGGCCCTATCCAGG + Intergenic
1000383497 5:160650462-160650484 TTCTTATCAGGACCCTTTTCAGG + Intronic
1002769504 6:278738-278760 TTCTTACGAGAGCCACATCCAGG - Intergenic
1008026062 6:46637129-46637151 TTCTGGTGAGGGCTCCTTCCGGG - Intronic
1010165586 6:72911397-72911419 TTCTGGTGAGGCCCCCTTCCGGG - Intronic
1010470483 6:76221298-76221320 TTATTTTCAGGGTCCCTTCCAGG - Intergenic
1011667041 6:89644375-89644397 TCTTTCTGAGTGCCCCTTCCAGG + Intronic
1016917239 6:149255272-149255294 TCCTGGTGAGGGCCTCTTCCTGG - Intronic
1017193830 6:151680149-151680171 TTCTGGTGAGGGCCTCTTCCAGG + Intronic
1018785348 6:167103713-167103735 GTCTGGTGAGGGCCACTTCCTGG - Intergenic
1019813342 7:3181414-3181436 TCCTGGTGAGTGCCCCTTCCCGG + Intergenic
1020076680 7:5263171-5263193 GTCTTATAAGAGCCACTTCCAGG + Intergenic
1020500323 7:8910768-8910790 TTCTTCTGAGTCCTCCTTCCTGG - Intergenic
1021954500 7:25810725-25810747 ATGTCATAAGGGCCCCTTCCTGG - Intergenic
1022474739 7:30702372-30702394 TTCTGATGAGGGCCCTCTCTTGG + Intronic
1023111429 7:36815248-36815270 TCCTGGTGAGGGCCTCTTCCTGG - Intergenic
1027334772 7:77138018-77138040 TTCTGATGAGGCCTTCTTCCTGG + Intronic
1029781029 7:102733084-102733106 TTCTGATGAGGCCTTCTTCCTGG - Intergenic
1031501292 7:122521111-122521133 CTCTTATGAAAGCCCTTTCCAGG - Intronic
1034511262 7:151536824-151536846 TTCTGATGAGGGCCCTCTCCTGG - Intergenic
1034590674 7:152136424-152136446 TTCATAGGAAGGCCCCTGCCCGG + Exonic
1035392041 7:158510847-158510869 TTCTTCTCAGGGCCGCTTGCTGG + Intronic
1036121371 8:6021098-6021120 TGCATTTGAAGGCCCCTTCCAGG - Intergenic
1036526613 8:9541014-9541036 TTCTGATGAGGGGATCTTCCTGG + Intergenic
1039075568 8:33688001-33688023 TTCTGGTGAGGGCCTCTGCCAGG + Intergenic
1041751110 8:61261719-61261741 TTCTTATGAGGGCCCCTTCCTGG - Intronic
1041776628 8:61529775-61529797 TTCTGGTGAGGGCCACTTTCTGG + Intronic
1045108530 8:98917598-98917620 GTCTGATGAGGGCCTCTTTCTGG - Intronic
1045651304 8:104343829-104343851 TTCTGGTGAGGACCCCTCCCCGG - Intronic
1046875673 8:119252107-119252129 TTCCTATTAGGACCTCTTCCTGG - Intergenic
1047597455 8:126393316-126393338 GTCTTGTGAGGGCCCCTTTCTGG - Intergenic
1049069217 8:140344194-140344216 GTCCTGTGAGGGCCACTTCCTGG - Intronic
1053103514 9:35391006-35391028 TTCTTAGGTGGCCCACTTCCTGG + Intronic
1055803760 9:80069632-80069654 TTCTGTTGAGGGCCCTTTTCCGG - Intergenic
1055982051 9:82013858-82013880 TTCTTCTCATGGCTCCTTCCAGG + Intergenic
1057056292 9:91963744-91963766 ATCTGGTGAGGGCCTCTTCCTGG - Intergenic
1057566428 9:96169499-96169521 TTCTGTTGGTGGCCCCTTCCCGG + Intergenic
1059541895 9:115138553-115138575 GTCTAGTGAGGGCCCCTTCCTGG - Intergenic
1062196519 9:135277074-135277096 TTCCTACCAGGGCCCCTTGCTGG - Intergenic
1062420018 9:136476135-136476157 TTCAGATATGGGCCCCTTCCTGG - Exonic
1186019106 X:5234446-5234468 TTCTTATGAGGGTGTCTTCTTGG - Intergenic
1186364790 X:8879971-8879993 GGCTTAATAGGGCCCCTTCCCGG - Intergenic
1187678147 X:21738749-21738771 TTCTAAGGCGGGCCCATTCCTGG + Intronic
1188948651 X:36340486-36340508 TTCTTCTGAGGCCTCTTTCCTGG + Intronic
1192197150 X:69036158-69036180 TTCTTCTGAGTCCCCTTTCCTGG + Intergenic
1195981295 X:110581293-110581315 ATCTTATGAGTTACCCTTCCTGG + Intergenic
1197508207 X:127335346-127335368 TTCTGGTGAGGTCTCCTTCCTGG - Intergenic
1199254931 X:145709008-145709030 TTCTTGTGAGGGCCCTCTTCTGG + Intergenic
1200078310 X:153562886-153562908 TCCTGGTGAGGGCTCCTTCCTGG + Intronic