ID: 1041752616

View in Genome Browser
Species Human (GRCh38)
Location 8:61277458-61277480
Sequence TCTTTGTCCTGCATTACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 184}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041752616_1041752623 1 Left 1041752616 8:61277458-61277480 CCCCCAGTAATGCAGGACAAAGA 0: 1
1: 0
2: 1
3: 19
4: 184
Right 1041752623 8:61277482-61277504 ACAGGTGAAGACAGAAGGGATGG No data
1041752616_1041752629 24 Left 1041752616 8:61277458-61277480 CCCCCAGTAATGCAGGACAAAGA 0: 1
1: 0
2: 1
3: 19
4: 184
Right 1041752629 8:61277505-61277527 TCTATGGGTGAGTATAGGGGAGG No data
1041752616_1041752628 21 Left 1041752616 8:61277458-61277480 CCCCCAGTAATGCAGGACAAAGA 0: 1
1: 0
2: 1
3: 19
4: 184
Right 1041752628 8:61277502-61277524 TGGTCTATGGGTGAGTATAGGGG No data
1041752616_1041752624 8 Left 1041752616 8:61277458-61277480 CCCCCAGTAATGCAGGACAAAGA 0: 1
1: 0
2: 1
3: 19
4: 184
Right 1041752624 8:61277489-61277511 AAGACAGAAGGGATGGTCTATGG No data
1041752616_1041752622 -3 Left 1041752616 8:61277458-61277480 CCCCCAGTAATGCAGGACAAAGA 0: 1
1: 0
2: 1
3: 19
4: 184
Right 1041752622 8:61277478-61277500 AGACACAGGTGAAGACAGAAGGG No data
1041752616_1041752625 9 Left 1041752616 8:61277458-61277480 CCCCCAGTAATGCAGGACAAAGA 0: 1
1: 0
2: 1
3: 19
4: 184
Right 1041752625 8:61277490-61277512 AGACAGAAGGGATGGTCTATGGG No data
1041752616_1041752626 19 Left 1041752616 8:61277458-61277480 CCCCCAGTAATGCAGGACAAAGA 0: 1
1: 0
2: 1
3: 19
4: 184
Right 1041752626 8:61277500-61277522 GATGGTCTATGGGTGAGTATAGG No data
1041752616_1041752621 -4 Left 1041752616 8:61277458-61277480 CCCCCAGTAATGCAGGACAAAGA 0: 1
1: 0
2: 1
3: 19
4: 184
Right 1041752621 8:61277477-61277499 AAGACACAGGTGAAGACAGAAGG No data
1041752616_1041752627 20 Left 1041752616 8:61277458-61277480 CCCCCAGTAATGCAGGACAAAGA 0: 1
1: 0
2: 1
3: 19
4: 184
Right 1041752627 8:61277501-61277523 ATGGTCTATGGGTGAGTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041752616 Original CRISPR TCTTTGTCCTGCATTACTGG GGG (reversed) Intronic
900076933 1:825508-825530 TTATTGTCCTGAATTCCTGGAGG - Intergenic
900330966 1:2134171-2134193 TCTTTGACCTGCGCTCCTGGAGG + Intronic
900523644 1:3117851-3117873 CCTTTGTCCTGCATTCCAAGTGG - Intronic
902224651 1:14988908-14988930 TCCTTGGCCTGGATTCCTGGGGG + Intronic
902375248 1:16027346-16027368 TCTCTGTCCGGGATTACTGGAGG + Exonic
902380210 1:16049156-16049178 TCTCTGTCTGGGATTACTGGAGG + Exonic
902647049 1:17806872-17806894 TCATTATCCTGCAGTTCTGGAGG + Intronic
906825215 1:48972041-48972063 CCTTTGTCCTGCATGACTATGGG + Intronic
907395323 1:54185655-54185677 TTTTTCTCCTGCCTTGCTGGAGG + Intronic
908267553 1:62394183-62394205 TCTCTTGCCTGGATTACTGGAGG + Intergenic
909132948 1:71762223-71762245 TCTTTTTCCTGCATTCCTGTGGG - Intronic
912812634 1:112805516-112805538 AATGTGTCCTGCATTTCTGGAGG + Intergenic
917851240 1:179066114-179066136 CCTTTGCCTTGAATTACTGGAGG + Intronic
918571671 1:186001300-186001322 TCTTTATCTTTAATTACTGGAGG - Exonic
918578469 1:186095308-186095330 TCTATGGCATGCATTACTGATGG + Exonic
924129519 1:240891184-240891206 TTTTTTTCCAGCATCACTGGGGG + Intronic
924622521 1:245674183-245674205 TCTGTGACCAGCTTTACTGGTGG - Intronic
924632674 1:245755985-245756007 TCTTTTTCCTGCCTTTCTGTGGG + Intronic
1063389356 10:5639218-5639240 CCTTTGTGCTGTATGACTGGAGG - Exonic
1064428957 10:15255012-15255034 TCTGTGTCCTGCATGAATGGGGG - Intronic
1064864651 10:19866221-19866243 TTATTGTCCTGCATTTCTGGAGG + Intronic
1064969478 10:21049682-21049704 TCTTTGTTCTGCTTTACTGCTGG + Intronic
1065233497 10:23622595-23622617 CCTTTGTTCTGCATGACAGGTGG - Intergenic
1068069513 10:52179319-52179341 TATTTTTCCTTCATTACTGAAGG + Intronic
1068146173 10:53073696-53073718 TATTAGTCCTGCTTTACTGTTGG - Intergenic
1069586378 10:69606100-69606122 CCTTTGTCCTTCATTTCTGAAGG - Intergenic
1072416818 10:95254047-95254069 TCTTTTTCCTGCTTTCCTGTGGG - Intronic
1073495831 10:103890217-103890239 TGTCTGACCTGCCTTACTGGAGG + Intronic
1075990017 10:126827934-126827956 TATTTGTCCTTCATTTTTGGAGG - Intergenic
1076470663 10:130715985-130716007 TCTTTGCTCTGCAGTTCTGGGGG + Intergenic
1076740336 10:132479692-132479714 TCCTTGTCCTGCAGGCCTGGAGG + Intergenic
1078159346 11:8827474-8827496 GCTGTGTCATGCATTACTGATGG - Intronic
1078862075 11:15257858-15257880 TCATTGTCATGCAGTTCTGGAGG - Intergenic
1079258652 11:18855322-18855344 TCTTTGTCCTTTCTTACTGTTGG - Intergenic
1082745849 11:56962057-56962079 TCTTTTTCCTGCATTTCTGTGGG - Intergenic
1082750920 11:57016139-57016161 TCTTTTTCCCGCATTTCTGTGGG - Intergenic
1082862104 11:57866728-57866750 TCTTTGCCCTGCCTTTCTGTGGG - Intergenic
1083891589 11:65598341-65598363 TCTGTGCCCTGCAGTCCTGGGGG + Exonic
1084069747 11:66726891-66726913 TCTTTCTCTTGCCTTCCTGGAGG - Intronic
1084178506 11:67435415-67435437 TCTTTGTGCTGCATGCCTAGGGG + Intergenic
1085238975 11:75036228-75036250 TTTATGTCCTGCAGTTCTGGGGG - Intergenic
1086038396 11:82444626-82444648 TCTCTCTCCTGCTTCACTGGCGG + Intergenic
1086176605 11:83899357-83899379 TCCCTCTCCTGCATTTCTGGAGG + Intronic
1086535496 11:87839890-87839912 TCTTTGTCCTGCATATCAGTAGG + Intergenic
1086803823 11:91213835-91213857 TCTTTGTCCTGCCTTACACTGGG - Intergenic
1087877670 11:103376869-103376891 TATTTCTCCTTCATTTCTGGAGG + Intronic
1092637503 12:10467358-10467380 TCTTTGTCCTTCATTTTTGTTGG + Intergenic
1093715218 12:22374259-22374281 TCTTTGGCCATGATTACTGGGGG + Intronic
1094114127 12:26891727-26891749 GCTATATCCTGCATTACTGAGGG - Intergenic
1094194817 12:27737368-27737390 TCTTTGTAGTTCATTACTTGAGG - Intronic
1100287888 12:93184705-93184727 TCTTGGTGCTGCATTATGGGAGG - Intergenic
1101091630 12:101292758-101292780 GTTTTATCCTGCATTAGTGGAGG + Intronic
1103920922 12:124398833-124398855 TCCTTGTCCTGGATGAGTGGGGG - Intronic
1104940845 12:132394016-132394038 CCCCTGTCCTGCATCACTGGGGG + Intergenic
1105981249 13:25518694-25518716 GCTTTCTGCTGCATTTCTGGAGG + Intronic
1106260790 13:28064743-28064765 GTTTTCTCCTGCATTGCTGGGGG + Intronic
1110015447 13:70394489-70394511 TATTTGACCTGCAAAACTGGGGG + Intergenic
1110640259 13:77815698-77815720 TTTTTGTCTTGCAGTTCTGGAGG - Intergenic
1111282081 13:86039661-86039683 TCTTTTTCCTGCCTTACTGCAGG + Intergenic
1112844953 13:103630685-103630707 TCTTTGTTCTTCTTTACTCGTGG + Intergenic
1116405496 14:44560748-44560770 TGTATGTCCTGCATCACTAGAGG + Intergenic
1120014800 14:79459557-79459579 TCATTGTCTTGCAATTCTGGAGG - Intronic
1121029102 14:90642903-90642925 TGTTTGTCCTGAGTTACTGAGGG - Intronic
1122158755 14:99767766-99767788 GCTTTGTCTTGCATTACTGTTGG + Intronic
1123121729 14:105919847-105919869 GCCATGTCCTGCATTGCTGGAGG - Intronic
1123404434 15:20011498-20011520 GCCATGTCCTGCATTGCTGGAGG - Intergenic
1123411246 15:20061861-20061883 ACTTTATCATGCATTTCTGGTGG - Intergenic
1123513767 15:21018145-21018167 GCCATGTCCTGCATTGCTGGAGG - Intergenic
1123520592 15:21068972-21068994 ACTTTATCATGCATTTCTGGTGG - Intergenic
1123774956 15:23569714-23569736 TCTTTCTCCTGCACGACTGCAGG - Intronic
1129476404 15:75786873-75786895 TGGGTGTCCTGCATTACAGGAGG - Intergenic
1131727680 15:95244569-95244591 TCTTTGGCCTCCCTTACTGCTGG + Intergenic
1132753704 16:1471506-1471528 TCTTGGTGCTGCTTTTCTGGGGG - Intronic
1137776736 16:51061233-51061255 GCTGTGTCATGCATTACTGAGGG - Intergenic
1137927626 16:52555800-52555822 TCTTTCTACTGCATCACTGCAGG + Intergenic
1140112464 16:72015665-72015687 TCTTTCTGCTGCATTGCAGGTGG + Intronic
1141330837 16:83109166-83109188 TCTTTTCCCTGCTTTACTGTAGG - Intronic
1141797055 16:86282144-86282166 TCTTTTGCCTGCAATACTGTTGG + Intergenic
1144628871 17:16859784-16859806 GCTCTCTCCTGCATTACTGGTGG + Intergenic
1145160439 17:20570351-20570373 GCTCTCTCCTGCATTACTGGTGG + Intergenic
1145393060 17:22470855-22470877 TGTTTGTGCTACATTTCTGGAGG - Intergenic
1146847003 17:36188412-36188434 TCTTATTCCAGCTTTACTGGTGG + Intronic
1147124165 17:38354053-38354075 TTTTTTTCCTGCATTTCTGAGGG + Intronic
1147501931 17:40973888-40973910 TCTTTTTCCTGCCTTTCTGTGGG + Intergenic
1147674047 17:42192809-42192831 TCTTTGCCCACCATGACTGGAGG + Intronic
1148736134 17:49865913-49865935 TCTTTCCCCTGCATTCCTGGGGG + Intergenic
1151125967 17:71845147-71845169 TCTTTGTTCTTAATTATTGGTGG - Intergenic
1151332687 17:73420169-73420191 TCTTTCTCTGGCATTGCTGGGGG + Intronic
1151634157 17:75333039-75333061 TCTTTCTCCTTCCTTACTGAGGG - Intronic
1152308177 17:79533261-79533283 TCTTTGTCCTCCCCAACTGGAGG + Intergenic
1156468140 18:37361061-37361083 TGTATGTCCAGCATTGCTGGGGG - Intronic
1159517568 18:69476867-69476889 TCTCTGTCCTGCTGTCCTGGAGG - Intronic
1159817764 18:73097913-73097935 TCTTTTTCCTGCATTCCTGTGGG + Intergenic
1160863565 19:1247904-1247926 TGCATGTCCTGCATTAATGGGGG + Intergenic
1164474193 19:28562579-28562601 TCTTTGTCCTGGCTTCCTGAGGG - Intergenic
1167862987 19:52300027-52300049 TCTGTGTCCTCCATTTCTGAGGG + Intronic
1167868584 19:52348784-52348806 TCTGTGTCCTCCATTTCTGAGGG + Intronic
1167883994 19:52485473-52485495 TCTGTGTCCTCCATTTCTGAGGG + Intronic
1167886131 19:52501458-52501480 TCTGAGTCCTGCATTTCTGAGGG + Intronic
1167912595 19:52716258-52716280 TCTGAGTCCTGCATTTCTGAGGG - Intronic
1167920482 19:52779250-52779272 TCTTTGTCCTCCATTTCTGAGGG - Intronic
1167927570 19:52833973-52833995 TCTGAGTCCTCCATTTCTGGGGG - Intronic
925023944 2:593556-593578 TCCTTTTCCTGGTTTACTGGAGG - Intergenic
925777646 2:7350236-7350258 TCTTTGTGCTGCAGTTCTGTTGG - Intergenic
926531534 2:14052467-14052489 TCTTTGTACTGCCTTTCTCGGGG - Intergenic
928110911 2:28507975-28507997 TCTTTGGCCAGCATTCCTGATGG + Intronic
930810542 2:55535921-55535943 TGTATGTCGTGCATTACTGCTGG + Intronic
932628620 2:73319195-73319217 TCTTTGTCCTGCCTTGATTGAGG - Intergenic
932798320 2:74716733-74716755 TCTTTGTCTTGCAGTACTGGTGG - Intergenic
932876849 2:75461390-75461412 TCTTTTTCTTGTATTAATGGGGG - Intergenic
934646752 2:96063411-96063433 TCTGTGCCCTGCATGCCTGGGGG + Intergenic
934840155 2:97619493-97619515 TCTGTGCCCTGCATGCCTGGGGG + Intergenic
935444642 2:103143209-103143231 TCTCTGTCCAGCCTTCCTGGCGG + Intergenic
936982215 2:118275482-118275504 TTTTTCTCTTGCAGTACTGGAGG + Intergenic
938954630 2:136286432-136286454 TCATTGTCCTGCAGTTCTAGGGG + Intergenic
941885150 2:170520221-170520243 GCTTTGTCCTACATTGCAGGAGG - Intronic
942066941 2:172280411-172280433 TCTTTGCCCTGCATTTTTGGAGG + Intergenic
944074508 2:195713908-195713930 TCTTTGTCATGCATAACCTGTGG - Intronic
945011996 2:205474748-205474770 GCTATTTTCTGCATTACTGGTGG - Intronic
948189205 2:236045258-236045280 TCTACGTCCTGCATTTCTGTGGG + Intronic
1169462320 20:5806430-5806452 TCATTTTCCTGTATTACTGTGGG + Intronic
1169807170 20:9571432-9571454 TATTTGCCCTGCATTGCTTGGGG - Intronic
1170030112 20:11935712-11935734 TCTTTATCCTGAATGGCTGGTGG - Intergenic
1170517910 20:17151022-17151044 TTATTGTCTTGCATTTCTGGAGG + Intergenic
1171069349 20:22051555-22051577 ACTTTCTCCTTCATTCCTGGTGG - Intergenic
1171258194 20:23707644-23707666 TCTTTGAGCTGCCTTACTGCTGG - Intergenic
1175407924 20:58746773-58746795 TGTTTCTCCTGCCTTTCTGGAGG - Intergenic
1175541169 20:59748576-59748598 TCTTTGTGATGGATTCCTGGAGG + Intronic
1178702372 21:34844558-34844580 TATTTGTCCAGCATTTATGGAGG - Intronic
1181603872 22:23968059-23968081 TCTGGGTCCTGCATAGCTGGGGG + Intronic
1181604641 22:23973248-23973270 TCTGGGTCCTGCATAGCTGGGGG - Intronic
1182091623 22:27599372-27599394 TTTCTTTCCTGCATTAATGGTGG + Intergenic
1184002268 22:41683748-41683770 TCACTGTCATGCATTGCTGGTGG - Intronic
1184169817 22:42752282-42752304 CCTTTGTCCTGCTTTCCTGGGGG - Intergenic
1185040677 22:48502385-48502407 CCTTGGTGCTGCATTTCTGGGGG + Intronic
952512897 3:34074977-34074999 TCTTTGTACTCCATTACTCAAGG - Intergenic
954533773 3:51342868-51342890 CCTTTGCCCTGAATTTCTGGAGG + Intronic
962121720 3:132567527-132567549 TCCTTTTCCTGCATTCCTGTGGG - Intronic
962493314 3:135915117-135915139 TCTTTGTCCCTCTTTACTGCAGG + Intergenic
962761249 3:138517183-138517205 TCTTTGTCCTTTATTACTTTAGG + Intronic
962850038 3:139301527-139301549 TCTTTGTTCTGCTTTACAGAGGG - Intronic
964682662 3:159359370-159359392 TCTTTGCCCTGCCTTTCTGATGG + Intronic
968496718 4:922111-922133 TATTTATCCTTCATTACTTGAGG - Intronic
970660921 4:18284878-18284900 TGTTTGTCATGCGTCACTGGGGG + Intergenic
974075073 4:57161160-57161182 TTCTAGTCTTGCATTACTGGTGG + Intergenic
974314626 4:60263117-60263139 TCATTGTCATGCTTTACTGTGGG + Intergenic
974638935 4:64604537-64604559 TCTTTGTCCTTTTTTACTGTTGG + Intergenic
975271648 4:72442323-72442345 TATTTGTCCTGCAGTTCTGCAGG + Intronic
976671370 4:87658182-87658204 TCTTTGGCCTGCAACACTGCAGG - Intronic
978860030 4:113438035-113438057 TCTTTGTCCTATGTTACTTGGGG - Intergenic
982578221 4:157144792-157144814 TCTCTCTCCTGACTTACTGGAGG + Intronic
982905045 4:161057366-161057388 CCGTGGTCCTGCACTACTGGAGG + Intergenic
983240702 4:165229067-165229089 TCTTTGTTTTGCATTGTTGGAGG + Intronic
984568496 4:181360895-181360917 TTTTTTTCCTGCATTGCTTGAGG + Intergenic
985224089 4:187740507-187740529 TCTGGGTGCTGCAATACTGGGGG - Intergenic
991423134 5:66462061-66462083 TCTTTGTCCTGCAAAAGTTGGGG + Intergenic
991485517 5:67131794-67131816 TCTTTTTCCTGTGTTACAGGGGG + Exonic
992542009 5:77775368-77775390 TAGTTGTCCTGCCTTTCTGGAGG + Intronic
992743426 5:79796032-79796054 TCTGTGTCCTGCAGAACTGGTGG + Intronic
992969395 5:82040405-82040427 GCATTCTCATGCATTACTGGTGG + Intronic
993267907 5:85751164-85751186 TCTATGTCCCACATTACTGCAGG + Intergenic
993360827 5:86973900-86973922 TCTCTGTCTTCCATTACTGAGGG - Intergenic
996928075 5:128852771-128852793 TCATTGTCTTGCAGTTCTGGAGG + Intronic
997487071 5:134240251-134240273 GCATTCTCCTGCATTGCTGGAGG - Intergenic
1008179063 6:48305143-48305165 TCTATATCCTCCATGACTGGAGG + Intergenic
1014866708 6:126540846-126540868 TCTTGGTCCTCCATTTCTGCAGG - Intergenic
1014932496 6:127350664-127350686 TATTTGTCCTTCATTTCTGAAGG - Intergenic
1015558508 6:134488264-134488286 TCTTTCTCCTTCATTTCTGAAGG - Intergenic
1018068133 6:160137898-160137920 TCTCTTACCTGCATTACTGTAGG + Intronic
1018101667 6:160445996-160446018 GCTTTGTCCTGATTTTCTGGGGG - Intronic
1018752920 6:166822685-166822707 TCTTTGTCCTGATTTTCTGCTGG - Intronic
1018990696 6:168671450-168671472 TCTCCGTCCTGCATCCCTGGGGG + Intronic
1018990715 6:168671503-168671525 TCTCCGTCCTGCATCCCTGGGGG + Intronic
1019401952 7:859948-859970 ACATGGTCCTGCATTATTGGAGG + Intronic
1023670032 7:42566312-42566334 TTTTTGTCCTGCTTTACCTGAGG - Intergenic
1024053717 7:45646279-45646301 TCTCTGTCCTGCAAAACTGAAGG - Intronic
1024247571 7:47481810-47481832 TCTTTGCCCTGCAGGACTGGTGG - Intronic
1024904787 7:54364737-54364759 TCTTTTTCCTGCTTTATTGATGG + Intergenic
1028536742 7:91896862-91896884 TCCTTCTCATGCATTACTGTTGG - Intergenic
1028807378 7:95044139-95044161 TGTTTGTCCTTTATTTCTGGAGG + Intronic
1034271430 7:149805187-149805209 TCTTTTTTCTGCTTTTCTGGGGG - Intergenic
1035516234 8:234366-234388 TTATTGTCCTGAATTCCTGGAGG + Intronic
1036422526 8:8611658-8611680 TCTTTGACCTGCCTTCCGGGAGG - Intergenic
1041380956 8:57254117-57254139 TCTTTGTCCTGTGTCACTGATGG - Intergenic
1041752616 8:61277458-61277480 TCTTTGTCCTGCATTACTGGGGG - Intronic
1041878145 8:62713423-62713445 TCTATATGTTGCATTACTGGAGG - Intronic
1049149456 8:141025238-141025260 TCCTTGTCCTACAGTTCTGGAGG + Intergenic
1049715375 8:144087335-144087357 TCTGTGTCCAGCATTATTCGAGG + Intergenic
1050422732 9:5483884-5483906 TCTTTGTTCTACCCTACTGGTGG + Intergenic
1050535252 9:6625235-6625257 TCTTTGGGCTGGATAACTGGCGG - Intronic
1051431736 9:16986330-16986352 CCTTTTTCCTGCATTGCTGGCGG - Intergenic
1051652549 9:19343415-19343437 CCTTTGCCCTTCATTAGTGGTGG + Intronic
1051918775 9:22238899-22238921 TCTTTGGCCTGCTTTCCTGAAGG + Intergenic
1054457194 9:65439290-65439312 TCTTTGTCCTTCATTTGTGGTGG - Intergenic
1058212204 9:102183346-102183368 TCTTTGTCCTTCCTTAGTGACGG - Intergenic
1060233755 9:121845318-121845340 TATTTCTCCTTCATTTCTGGAGG - Intronic
1060805789 9:126575391-126575413 ACTTTGTCCTGCATCATTAGGGG + Intergenic
1062659305 9:137620092-137620114 TTTTTTTCCTGCATTTTTGGGGG + Intronic
1188460169 X:30416285-30416307 TCTTTGTCCTCCATTCCCGCAGG - Intergenic
1193293630 X:79807850-79807872 TATTTGTCCTTCATGACTGAAGG + Intergenic
1196371616 X:114985483-114985505 TCTGTGTCCTGCTTTACAGTTGG - Intergenic
1196510226 X:116500320-116500342 TCTCTGTGCTGCATGGCTGGGGG + Intergenic
1202263237 Y:22991841-22991863 TCTTGGCCCTGCACTTCTGGTGG + Intronic
1202416227 Y:24625582-24625604 TCTTGGCCCTGCACTTCTGGTGG + Intronic
1202454560 Y:25044504-25044526 TCTTGGCCCTGCACTTCTGGTGG - Intronic