ID: 1041752617

View in Genome Browser
Species Human (GRCh38)
Location 8:61277459-61277481
Sequence GTCTTTGTCCTGCATTACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 164}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041752617_1041752623 0 Left 1041752617 8:61277459-61277481 CCCCAGTAATGCAGGACAAAGAC 0: 1
1: 0
2: 1
3: 18
4: 164
Right 1041752623 8:61277482-61277504 ACAGGTGAAGACAGAAGGGATGG No data
1041752617_1041752624 7 Left 1041752617 8:61277459-61277481 CCCCAGTAATGCAGGACAAAGAC 0: 1
1: 0
2: 1
3: 18
4: 164
Right 1041752624 8:61277489-61277511 AAGACAGAAGGGATGGTCTATGG No data
1041752617_1041752627 19 Left 1041752617 8:61277459-61277481 CCCCAGTAATGCAGGACAAAGAC 0: 1
1: 0
2: 1
3: 18
4: 164
Right 1041752627 8:61277501-61277523 ATGGTCTATGGGTGAGTATAGGG No data
1041752617_1041752622 -4 Left 1041752617 8:61277459-61277481 CCCCAGTAATGCAGGACAAAGAC 0: 1
1: 0
2: 1
3: 18
4: 164
Right 1041752622 8:61277478-61277500 AGACACAGGTGAAGACAGAAGGG No data
1041752617_1041752629 23 Left 1041752617 8:61277459-61277481 CCCCAGTAATGCAGGACAAAGAC 0: 1
1: 0
2: 1
3: 18
4: 164
Right 1041752629 8:61277505-61277527 TCTATGGGTGAGTATAGGGGAGG No data
1041752617_1041752621 -5 Left 1041752617 8:61277459-61277481 CCCCAGTAATGCAGGACAAAGAC 0: 1
1: 0
2: 1
3: 18
4: 164
Right 1041752621 8:61277477-61277499 AAGACACAGGTGAAGACAGAAGG No data
1041752617_1041752625 8 Left 1041752617 8:61277459-61277481 CCCCAGTAATGCAGGACAAAGAC 0: 1
1: 0
2: 1
3: 18
4: 164
Right 1041752625 8:61277490-61277512 AGACAGAAGGGATGGTCTATGGG No data
1041752617_1041752626 18 Left 1041752617 8:61277459-61277481 CCCCAGTAATGCAGGACAAAGAC 0: 1
1: 0
2: 1
3: 18
4: 164
Right 1041752626 8:61277500-61277522 GATGGTCTATGGGTGAGTATAGG No data
1041752617_1041752628 20 Left 1041752617 8:61277459-61277481 CCCCAGTAATGCAGGACAAAGAC 0: 1
1: 0
2: 1
3: 18
4: 164
Right 1041752628 8:61277502-61277524 TGGTCTATGGGTGAGTATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041752617 Original CRISPR GTCTTTGTCCTGCATTACTG GGG (reversed) Intronic
902261745 1:15230488-15230510 GTGTTTGTGAAGCATTACTGTGG - Intergenic
903277755 1:22232725-22232747 GTTTGTGTCCTGCATTTGTGAGG + Intergenic
905098696 1:35498943-35498965 GTCTTCTTCCTGCATTAGTGGGG + Intronic
905279186 1:36837970-36837992 GTCTAGGTCCTGGACTACTGTGG + Intronic
906825213 1:48972040-48972062 GCCTTTGTCCTGCATGACTATGG + Intronic
909132949 1:71762224-71762246 TTCTTTTTCCTGCATTCCTGTGG - Intronic
909146307 1:71937649-71937671 GTCTTTGATCTGCATTACAGTGG - Intronic
909939753 1:81597619-81597641 ATCTTTGTCTTACATTTCTGGGG - Intronic
913326383 1:117632017-117632039 GTCTTTGTCCTGCATTTTACAGG + Intergenic
914882351 1:151557045-151557067 TTCTTTTTCCTGCCTTCCTGTGG + Intronic
916639626 1:166713206-166713228 TTCTTTATCCTCCATTTCTGAGG - Intergenic
919678229 1:200408844-200408866 GTCTTTCTCCTGTATGAATGAGG + Exonic
919866356 1:201786131-201786153 GTCTCTGTCCTGAACTTCTGAGG + Intronic
920542234 1:206787659-206787681 TTCTTTCTCCTGCTTTACAGAGG + Intergenic
920951222 1:210573428-210573450 GCCTTTGTGCTGGATTACTTGGG - Intronic
922005076 1:221522141-221522163 GTCTTTGTCCTCCATCTTTGTGG + Intergenic
923543560 1:234907512-234907534 GTTTTTTTCCTGCATTTCTCAGG - Intergenic
924632673 1:245755984-245756006 TTCTTTTTCCTGCCTTTCTGTGG + Intronic
924852263 1:247842345-247842367 GTTTTTGTCCAGCTTTATTGAGG - Intergenic
1063079308 10:2750157-2750179 TTCTTAGTACTGCATTTCTGTGG + Intergenic
1064428958 10:15255013-15255035 CTCTGTGTCCTGCATGAATGGGG - Intronic
1072416819 10:95254048-95254070 TTCTTTTTCCTGCTTTCCTGTGG - Intronic
1073039262 10:100589520-100589542 TTCTTTTTCCTGCCTTTCTGGGG - Intergenic
1073138247 10:101231269-101231291 ATCTTTGTCCTGCATTTTCGGGG + Intergenic
1076378197 10:130006493-130006515 CTCTTTGTCCTCCATATCTGTGG - Intergenic
1076614931 10:131749020-131749042 GTCAGAGTCCTGCATTCCTGCGG - Intergenic
1077418575 11:2437431-2437453 GTGTCTGTCCTGCACCACTGTGG + Intergenic
1082745850 11:56962058-56962080 TTCTTTTTCCTGCATTTCTGTGG - Intergenic
1082750921 11:57016140-57016162 TTCTTTTTCCCGCATTTCTGTGG - Intergenic
1082862105 11:57866729-57866751 GTCTTTGCCCTGCCTTTCTGTGG - Intergenic
1083891588 11:65598340-65598362 GTCTGTGCCCTGCAGTCCTGGGG + Exonic
1084469435 11:69348404-69348426 GTTTTTATCCTGCATTAAGGAGG + Intronic
1086803824 11:91213836-91213858 TTCTTTGTCCTGCCTTACACTGG - Intergenic
1087971148 11:104485913-104485935 GTATTTGTCCTGCAATTTTGTGG - Intergenic
1089243661 11:117102143-117102165 GCCTTTGTCTTGCATTACAGGGG - Intergenic
1093744831 12:22728553-22728575 TTCTTTTTCCAGCTTTACTGAGG - Intergenic
1093772654 12:23035556-23035578 GGCTTTATTCTGCATTACTCTGG + Intergenic
1093987855 12:25557391-25557413 GTCTTAGATCTGCATTTCTGAGG + Intronic
1094114128 12:26891728-26891750 GGCTATATCCTGCATTACTGAGG - Intergenic
1096003658 12:48150673-48150695 GTTTTTGTCTTTCATTAATGAGG - Intronic
1097519407 12:60648307-60648329 ATCTTTGGCCTGCATTCCTCTGG - Intergenic
1102419408 12:112792025-112792047 GTCTTGGTCCTGCATGATTTAGG + Intronic
1102591160 12:113957851-113957873 GTCTCTTTCCTGCAGGACTGGGG + Exonic
1106403109 13:29448546-29448568 AGCTTTGTCCAGCAGTACTGGGG - Intronic
1107736620 13:43405640-43405662 GTCTTAGTCATCCATTCCTGTGG + Intronic
1107765755 13:43732834-43732856 TGCTTTGTCTTGCATTACTGGGG - Intronic
1108512083 13:51165441-51165463 GTCTTCTTCCTGCATTAGTCAGG - Intergenic
1109285808 13:60407461-60407483 GGCTATTTCCTGCATTTCTGAGG - Intronic
1111555391 13:89874682-89874704 ATCTTTGTGCTCCATGACTGGGG + Intergenic
1113002030 13:105651369-105651391 GTCTTTTTTCTTCATTAGTGTGG - Intergenic
1115861067 14:37687018-37687040 TTCTGTGTCCTGGTTTACTGTGG - Intronic
1116512479 14:45763940-45763962 CTCTTTCTCCTTTATTACTGAGG - Intergenic
1116575038 14:46563398-46563420 CTCATAGTTCTGCATTACTGGGG + Intergenic
1116676772 14:47916310-47916332 TCCTTTGTCCTGCAATACTCTGG + Intergenic
1117788347 14:59311365-59311387 GTCTCTGTCCTCCACTCCTGGGG - Intronic
1118029541 14:61806997-61807019 GTCTTTGTCCTACCTTATTCTGG + Intergenic
1121029103 14:90642904-90642926 TTGTTTGTCCTGAGTTACTGAGG - Intronic
1122261414 14:100525414-100525436 CACTTGCTCCTGCATTACTGTGG + Intronic
1124580415 15:30949097-30949119 GGTTTTGTCCTTTATTACTGTGG - Intronic
1125271603 15:37944828-37944850 GGCTATGTCCTGTATTTCTGTGG - Intronic
1126478216 15:49089618-49089640 TTCTTTGTCCTACATTATTAGGG - Intergenic
1127173784 15:56331716-56331738 TTCTTTAACATGCATTACTGGGG - Intronic
1127630193 15:60820768-60820790 GTCTTGGTTTTTCATTACTGAGG + Intronic
1127640160 15:60908714-60908736 ATATTTAGCCTGCATTACTGGGG - Intronic
1128898794 15:71399997-71400019 TTCTTTCTGCAGCATTACTGAGG - Intronic
1129989110 15:79946522-79946544 GTCTTTGTCTTTCATGACTTTGG - Intergenic
1130776669 15:86991524-86991546 GATTTTGTCCTGCATTGCTTTGG - Intronic
1133452335 16:5914152-5914174 GTCTTTTTCCTGGATTATTTTGG - Intergenic
1134516315 16:14889947-14889969 GTGGTTGTCCTGCATCCCTGTGG - Intronic
1134703989 16:16288599-16288621 GTGGTTGTCCTGCATCCCTGTGG - Intronic
1134963554 16:18423515-18423537 GTGGTTGTCCTGCATCCCTGTGG + Intronic
1134967849 16:18506114-18506136 GTGGTTGTCCTGCATCCCTGTGG + Intronic
1137776737 16:51061234-51061256 TGCTGTGTCATGCATTACTGAGG - Intergenic
1139805462 16:69561838-69561860 GTCTTTGACTTGAATTACTCTGG + Intergenic
1140574730 16:76153648-76153670 GTCTTTTTCCAACATTACAGAGG - Intergenic
1140767004 16:78169346-78169368 GTCTGAGTCCTGCATTACCATGG + Intronic
1147124164 17:38354052-38354074 GTTTTTTTCCTGCATTTCTGAGG + Intronic
1147501930 17:40973887-40973909 TTCTTTTTCCTGCCTTTCTGTGG + Intergenic
1148449260 17:47764466-47764488 TTCTTTTTCCTGCCTTCCTGTGG + Intergenic
1148736133 17:49865912-49865934 TTCTTTCCCCTGCATTCCTGGGG + Intergenic
1151332686 17:73420168-73420190 GTCTTTCTCTGGCATTGCTGGGG + Intronic
1151634158 17:75333040-75333062 TTCTTTCTCCTTCCTTACTGAGG - Intronic
1152547155 17:81006297-81006319 GGCTTTGACCTGCATTTCTCTGG + Intronic
1153988690 18:10376134-10376156 GTCTTTGTACAACATTACTGTGG - Intergenic
1157452207 18:47797252-47797274 GGCTCTGTCCTGCTTTACTGGGG + Intergenic
1158482192 18:57831661-57831683 GTCTGTGTCCTAAATTACTCTGG - Intergenic
1159817763 18:73097912-73097934 TTCTTTTTCCTGCATTCCTGTGG + Intergenic
1160432662 18:78822628-78822650 GTCTCTGTCCTGCTGTCCTGTGG + Intergenic
1160863564 19:1247903-1247925 GTGCATGTCCTGCATTAATGGGG + Intergenic
1164474194 19:28562580-28562602 GTCTTTGTCCTGGCTTCCTGAGG - Intergenic
1165927340 19:39335294-39335316 GTCTTTGTCCACCTTCACTGGGG + Exonic
1167862986 19:52300026-52300048 CTCTGTGTCCTCCATTTCTGAGG + Intronic
1167868583 19:52348783-52348805 CTCTGTGTCCTCCATTTCTGAGG + Intronic
1167883993 19:52485472-52485494 CTCTGTGTCCTCCATTTCTGAGG + Intronic
1167886130 19:52501457-52501479 CTCTGAGTCCTGCATTTCTGAGG + Intronic
1167912596 19:52716259-52716281 CTCTGAGTCCTGCATTTCTGAGG - Intronic
1167920483 19:52779251-52779273 ATCTTTGTCCTCCATTTCTGAGG - Intronic
1168253337 19:55153887-55153909 GTCTTCCTCTTGCATTTCTGAGG + Intronic
928823763 2:35393558-35393580 GTATTTCTCCTGCTTGACTGTGG + Intergenic
930659551 2:54040089-54040111 GTCTTTTACCTAAATTACTGTGG - Intronic
931050009 2:58402141-58402163 TTCTTTCTCCTGAATTGCTGTGG - Intergenic
931296920 2:60936581-60936603 TTCTCTGTGGTGCATTACTGAGG - Intergenic
935663679 2:105491085-105491107 GCACTTGTGCTGCATTACTGTGG + Intergenic
938954629 2:136286431-136286453 GTCATTGTCCTGCAGTTCTAGGG + Intergenic
940020776 2:149153906-149153928 GCACTTGTCCTTCATTACTGTGG + Intronic
941702862 2:168623457-168623479 TTTTTTTTCCTGCTTTACTGAGG - Intronic
945218506 2:207460678-207460700 GTCTTTGGTCTTCATTTCTGAGG + Intergenic
945865432 2:215169226-215169248 GACTTTGTCCTGCTGTAATGGGG - Intergenic
947124400 2:226852191-226852213 GCCTTGGACCTGCATTTCTGAGG + Intronic
947795196 2:232890114-232890136 GTCTCTGTCCTGTCTCACTGGGG + Intronic
948189204 2:236045257-236045279 ATCTACGTCCTGCATTTCTGTGG + Intronic
948572264 2:238925124-238925146 GTCTTTTCCCAGCATCACTGTGG + Intergenic
1169015999 20:2293251-2293273 GTCTTTTTACTACATTACTCTGG + Intergenic
1169462319 20:5806429-5806451 ATCATTTTCCTGTATTACTGTGG + Intronic
1174163822 20:48570620-48570642 GTCTTTGTCCTGTTCTCCTGAGG - Intergenic
1175431631 20:58909037-58909059 GACTTAGTGCTGCATAACTGTGG + Intronic
1176923249 21:14715570-14715592 GTGTTTTTCCTTCATTCCTGGGG - Intergenic
1179909248 21:44439206-44439228 GTGTTTGTCCTGCAGCCCTGGGG - Intronic
1181465346 22:23107878-23107900 GTCTGTGTCCTTCCTCACTGTGG - Intronic
1181750654 22:24986852-24986874 GGCTTTGTCCTTCATTTCTATGG - Intronic
1184103983 22:42356917-42356939 GTTTCTGTCCTGCATGAGTGTGG - Intergenic
1184169819 22:42752283-42752305 TCCTTTGTCCTGCTTTCCTGGGG - Intergenic
1185040675 22:48502384-48502406 GCCTTGGTGCTGCATTTCTGGGG + Intronic
951388777 3:22076249-22076271 TTCTTTATCCTCCATTATTGTGG + Intronic
953512037 3:43552004-43552026 TTCTTTTTCCTGTCTTACTGTGG + Intronic
953538318 3:43792837-43792859 GAATTTGTTCTGCATTTCTGGGG - Intergenic
953608920 3:44431206-44431228 GTTTTTGTCCTGGCTCACTGGGG - Intergenic
956250694 3:67231091-67231113 GTCTGTGTTAAGCATTACTGAGG - Intergenic
956722952 3:72134245-72134267 GTCTTTGTCCTACACAGCTGGGG + Intergenic
962121721 3:132567528-132567550 TTCCTTTTCCTGCATTCCTGTGG - Intronic
962850039 3:139301528-139301550 GTCTTTGTTCTGCTTTACAGAGG - Intronic
963953131 3:151224568-151224590 ATCTGTGTTCTGCATTCCTGTGG + Intronic
970627136 4:17898930-17898952 GACATTTTCATGCATTACTGTGG - Intronic
971338829 4:25749037-25749059 GTCTTTGTACCTCATCACTGGGG - Intronic
973551425 4:52038847-52038869 GTTTTTATCCTGCGATACTGGGG + Intergenic
974314625 4:60263116-60263138 TTCATTGTCATGCTTTACTGTGG + Intergenic
978336021 4:107670062-107670084 GTCTCTCACCTGAATTACTGTGG - Intronic
979522240 4:121681016-121681038 CTCTTTCTCCTGCCTGACTGAGG - Intronic
988076980 5:26365580-26365602 GTCTCAGTTCTGCATGACTGGGG - Intergenic
990113540 5:52358940-52358962 GACTTTTTCCAGCTTTACTGAGG + Intergenic
993360828 5:86973901-86973923 TTCTCTGTCTTCCATTACTGAGG - Intergenic
994398454 5:99248613-99248635 TTCTGTATCCTTCATTACTGGGG + Intergenic
995995485 5:118293141-118293163 GACTTTGTTCTGCATGGCTGGGG - Intergenic
1000257452 5:159553465-159553487 GTGTTGGTCTAGCATTACTGGGG - Intergenic
1001204139 5:169746286-169746308 GTCTTTCTACTTCATTTCTGTGG - Intronic
1003746254 6:9005810-9005832 GGCTGTGTCATTCATTACTGTGG + Intergenic
1004260438 6:14103010-14103032 GTCTTGGTCCTGCCTGACTCTGG + Intergenic
1004485492 6:16062616-16062638 GGCATTGCCCTCCATTACTGAGG - Intergenic
1005238858 6:23799579-23799601 GTTTTTGTACTGCCTTACAGAGG + Intergenic
1010547560 6:77176140-77176162 GTCTTTCACCTGGACTACTGTGG - Intergenic
1011585850 6:88924188-88924210 GACTTTGCCCTGCATTACCTGGG - Intronic
1012791701 6:103706919-103706941 GTCTTAGTCAGGCATCACTGTGG + Intergenic
1013911939 6:115286039-115286061 GTATTTTTCCAGCTTTACTGAGG + Intergenic
1015445189 6:133296006-133296028 GTATTTGTACTGTATTGCTGTGG + Intronic
1018176797 6:161184365-161184387 GTTTTTGTCCTGAATAGCTGGGG + Intronic
1020073984 7:5245602-5245624 GGCTATATCCTGCATTAATGTGG + Intergenic
1022785417 7:33632701-33632723 GTCATTGTCTTCCTTTACTGCGG - Intergenic
1023693466 7:42818898-42818920 GGCATTGTCCTGAAATACTGGGG - Intergenic
1024131368 7:46355893-46355915 GTCATTGTCCTTCTTCACTGAGG - Intergenic
1030240103 7:107313171-107313193 GTCTTTGTCCTGAAATACTGAGG - Intronic
1030704791 7:112680886-112680908 GTCTTTCTTCTGGATTATTGTGG + Intergenic
1032484553 7:132275504-132275526 GTCTTTTGCCAGCTTTACTGAGG - Intronic
1034547875 7:151800886-151800908 GTCTGCGTCTGGCATTACTGTGG - Intronic
1035823025 8:2615520-2615542 GTCTTTGTCCTTCAGCACTGAGG - Intergenic
1040995391 8:53395973-53395995 ATCTCTGTCCTGCATTAGCGGGG + Intergenic
1041752617 8:61277459-61277481 GTCTTTGTCCTGCATTACTGGGG - Intronic
1044062453 8:87654739-87654761 GTCTTTTACCTGCATTATTGCGG - Intergenic
1046212201 8:111091408-111091430 GTATTTTTCCAGCTTTACTGAGG - Intergenic
1046451726 8:114401225-114401247 GGCTTTGTCCTTTTTTACTGTGG - Intergenic
1049379646 8:142305571-142305593 GCTTTTGTCCTGCACTGCTGGGG - Intronic
1049941310 9:549101-549123 TTCTTTGTCCTGTTTTTCTGTGG - Exonic
1051337595 9:16080205-16080227 GCCTTTGTTCTGGATCACTGAGG - Intergenic
1051566854 9:18509421-18509443 GTTTTTATGCAGCATTACTGTGG - Intronic
1053085466 9:35216704-35216726 TTCTTTTTCCTGCCTTCCTGTGG - Intronic
1058381146 9:104378456-104378478 ATCTTTGTAGTGCATCACTGTGG - Intergenic
1059367681 9:113799440-113799462 GTCTTTCTCCTGCTAGACTGTGG + Intergenic
1061936152 9:133858759-133858781 GTCTGTGTCCTGCTTAGCTGTGG - Intronic
1062584635 9:137243772-137243794 GTAGTTGTCCTGCATGGCTGCGG + Exonic
1187711406 X:22058052-22058074 GTCCCTGTCCTGCCTTCCTGAGG - Intronic
1188661382 X:32763032-32763054 TTATTTCTCCTGCATTAATGGGG + Intronic
1188921102 X:35978884-35978906 GTCTTTGTCCTTCTTCCCTGAGG + Intronic
1189913315 X:45832916-45832938 TTCTTAGTCCTGCAAAACTGTGG - Intergenic
1190409322 X:50119214-50119236 ATTTTTTTCCTGCTTTACTGAGG + Intergenic
1196931433 X:120685327-120685349 GTGATAGGCCTGCATTACTGAGG + Intergenic